ID: 1023412645

View in Genome Browser
Species Human (GRCh38)
Location 7:39903031-39903053
Sequence CCATGGAGGAATCTGTATAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023412645_1023412652 -4 Left 1023412645 7:39903031-39903053 CCGGTATACAGATTCCTCCATGG No data
Right 1023412652 7:39903050-39903072 ATGGGAACCAGTGCCAGGGTAGG No data
1023412645_1023412655 26 Left 1023412645 7:39903031-39903053 CCGGTATACAGATTCCTCCATGG No data
Right 1023412655 7:39903080-39903102 AAATTGTAATTGATGAATTTCGG No data
1023412645_1023412649 -9 Left 1023412645 7:39903031-39903053 CCGGTATACAGATTCCTCCATGG No data
Right 1023412649 7:39903045-39903067 CCTCCATGGGAACCAGTGCCAGG No data
1023412645_1023412656 27 Left 1023412645 7:39903031-39903053 CCGGTATACAGATTCCTCCATGG No data
Right 1023412656 7:39903081-39903103 AATTGTAATTGATGAATTTCGGG No data
1023412645_1023412650 -8 Left 1023412645 7:39903031-39903053 CCGGTATACAGATTCCTCCATGG No data
Right 1023412650 7:39903046-39903068 CTCCATGGGAACCAGTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023412645 Original CRISPR CCATGGAGGAATCTGTATAC CGG (reversed) Intergenic
No off target data available for this crispr