ID: 1023412650

View in Genome Browser
Species Human (GRCh38)
Location 7:39903046-39903068
Sequence CTCCATGGGAACCAGTGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023412643_1023412650 5 Left 1023412643 7:39903018-39903040 CCCAAAGCAGAAACCGGTATACA No data
Right 1023412650 7:39903046-39903068 CTCCATGGGAACCAGTGCCAGGG No data
1023412644_1023412650 4 Left 1023412644 7:39903019-39903041 CCAAAGCAGAAACCGGTATACAG No data
Right 1023412650 7:39903046-39903068 CTCCATGGGAACCAGTGCCAGGG No data
1023412645_1023412650 -8 Left 1023412645 7:39903031-39903053 CCGGTATACAGATTCCTCCATGG No data
Right 1023412650 7:39903046-39903068 CTCCATGGGAACCAGTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023412650 Original CRISPR CTCCATGGGAACCAGTGCCA GGG Intergenic
No off target data available for this crispr