ID: 1023415293

View in Genome Browser
Species Human (GRCh38)
Location 7:39926600-39926622
Sequence AAGATTAAAGACTCTGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023415291_1023415293 -3 Left 1023415291 7:39926580-39926602 CCACAGTTTAAAGCATACTGAAG No data
Right 1023415293 7:39926600-39926622 AAGATTAAAGACTCTGTGGCTGG No data
1023415290_1023415293 18 Left 1023415290 7:39926559-39926581 CCTTACTCAATTGTTTCATTTCC No data
Right 1023415293 7:39926600-39926622 AAGATTAAAGACTCTGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023415293 Original CRISPR AAGATTAAAGACTCTGTGGC TGG Intergenic
No off target data available for this crispr