ID: 1023416224

View in Genome Browser
Species Human (GRCh38)
Location 7:39935508-39935530
Sequence TTGCAGAGGTTCAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023416224_1023416229 4 Left 1023416224 7:39935508-39935530 CCTTCCTCCCTGAACCTCTGCAA No data
Right 1023416229 7:39935535-39935557 TGATCTTTTTACTGCCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023416224 Original CRISPR TTGCAGAGGTTCAGGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr