ID: 1023424883

View in Genome Browser
Species Human (GRCh38)
Location 7:40025201-40025223
Sequence TGATAGGCTTAAAAATGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023424883_1023424885 26 Left 1023424883 7:40025201-40025223 CCACTGCATTTTTAAGCCTATCA 0: 1
1: 0
2: 0
3: 16
4: 186
Right 1023424885 7:40025250-40025272 ACTTACATATTTATCTGCAGTGG 0: 1
1: 0
2: 1
3: 18
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023424883 Original CRISPR TGATAGGCTTAAAAATGCAG TGG (reversed) Intronic
904575055 1:31500088-31500110 TGAGATGCTTAAATCTGCAGTGG + Intergenic
905150900 1:35926665-35926687 TGATAGGCTGAGAAATGCCTAGG + Exonic
908659908 1:66424646-66424668 TGATATGCCTCAAAATGGAGTGG + Intergenic
911263880 1:95720260-95720282 TGATAGTCTTAAATATGCCATGG - Intergenic
911751245 1:101500240-101500262 TGATATGCCTCAAAATGGAGTGG - Intergenic
913006694 1:114639853-114639875 TGATAGAATTAAAAAGGCAGTGG - Intronic
917625778 1:176844623-176844645 TGATAGGCTTCAATATGCAAAGG + Exonic
919350086 1:196440217-196440239 TGATGGGTTTAAAAATCCTGTGG - Intronic
919558491 1:199091625-199091647 TGATATGCTTCAAAATGGAGTGG - Intergenic
919574624 1:199292379-199292401 TAATAGGATTAAAAATCAAGAGG - Intergenic
922389047 1:225119707-225119729 TGATAGACTTAAATATGAAAAGG - Intronic
923292796 1:232562989-232563011 TGAATAGCTTAAAAATACAGTGG - Intergenic
1066721041 10:38339330-38339352 TGTAAGGCTTAAAAATGGACTGG - Intergenic
1073790248 10:106932920-106932942 TGATATGCTTTAAATTGCAGAGG - Intronic
1080046139 11:27810216-27810238 TGATGGCCTTACAAATCCAGGGG - Intergenic
1082117568 11:48343792-48343814 TGATAGATTTTGAAATGCAGTGG + Intergenic
1082906295 11:58311405-58311427 TGATATGCTTCAAAATGGAGTGG + Intergenic
1083228372 11:61299212-61299234 TGATGGGCTTAGAAATTCACTGG - Intergenic
1094101609 12:26770448-26770470 TGATTGGCTTTGGAATGCAGAGG - Intronic
1094196503 12:27755366-27755388 TGTTAGTCTTAAAAATGAGGAGG + Exonic
1095681090 12:44977025-44977047 TGATAGGCTTGATTATGCTGTGG - Intergenic
1098100559 12:67011576-67011598 TGTGAGGATTAAATATGCAGAGG - Intergenic
1098215383 12:68211041-68211063 TAATGGGCTCAAAAATACAGTGG - Intronic
1098621178 12:72601194-72601216 TGATAGGTTTAAAACTTCAGTGG + Intronic
1099376114 12:81897780-81897802 TGATATGCCTCAAAATGGAGTGG - Intergenic
1099785971 12:87264478-87264500 TTATTGTCTTAAAAATGCTGGGG - Intergenic
1100530451 12:95456976-95456998 TGATATGCCTCAAAATGAAGTGG + Intergenic
1104212406 12:126702028-126702050 TGTTTGGGATAAAAATGCAGTGG - Intergenic
1104306034 12:127611619-127611641 TGATATGCCTCAAAATGGAGTGG - Intergenic
1107564042 13:41583732-41583754 TGAAAAGCAAAAAAATGCAGTGG + Intronic
1108781433 13:53840930-53840952 TAACTGGCTTAAAAATGGAGGGG - Intergenic
1110640510 13:77818757-77818779 AGAGAGGCTTAAAACTGCAGAGG + Intergenic
1111133598 13:84008523-84008545 TGTTAATCTTAAAAATGTAGTGG - Intergenic
1111372404 13:87334964-87334986 TGATATGCCTCAAAATGGAGTGG - Intergenic
1111901263 13:94202205-94202227 TGATATGCTAAAACATGCAAAGG - Intronic
1115924437 14:38414792-38414814 TGATAAGCAGAAAAAAGCAGGGG + Intergenic
1116532471 14:45989697-45989719 TACGAGGCTTAAAAATGCATTGG - Intergenic
1116632927 14:47356922-47356944 TGATAGTCTGCAATATGCAGGGG - Intronic
1117833114 14:59773880-59773902 TGAAAGGGTCAAAAATGAAGAGG - Intronic
1119852542 14:77876307-77876329 TGACAGGGTAAAAAAGGCAGAGG - Intronic
1121311058 14:92935286-92935308 TGAGAGGCGAAAAAATTCAGAGG - Exonic
1125346824 15:38726906-38726928 TGCTAGGCATAAAGGTGCAGAGG + Intergenic
1126875072 15:53032550-53032572 TGAAAGGCTTAAAATTGCCAGGG - Intergenic
1127571474 15:60247101-60247123 TAATAGGCTTAAATATGCCAGGG - Intergenic
1131655823 15:94457651-94457673 GAACATGCTTAAAAATGCAGCGG + Intronic
1132206145 15:99987523-99987545 TGACTGGTTTAAAAAGGCAGTGG + Intronic
1133491055 16:6268451-6268473 AAATGTGCTTAAAAATGCAGAGG + Intronic
1138802119 16:60045950-60045972 TGGTAGGCTTAACTATGCACTGG - Intergenic
1139939888 16:70597485-70597507 TGCTAGGGTTAAAAGTGCTGGGG + Intronic
1143742336 17:8963890-8963912 TGTGAGGCTTCAAAAAGCAGGGG + Intronic
1146364113 17:32205505-32205527 TGTTAGCCTTAAAAATGTATAGG + Intronic
1149213321 17:54328046-54328068 TGATATGCCTCAAAATGGAGTGG + Intergenic
1154379950 18:13840020-13840042 GGATAGTCTTTAAAATTCAGAGG + Intergenic
1155091436 18:22515239-22515261 GGACCCGCTTAAAAATGCAGTGG + Intergenic
1155384050 18:25257690-25257712 TGATAGGTTGGAAAATGAAGAGG - Intronic
1155593878 18:27459965-27459987 TAATAGAATTAAAAATACAGAGG + Intergenic
1157127209 18:44967997-44968019 GGATAAGTTTGAAAATGCAGTGG + Intronic
1157182198 18:45507659-45507681 TCTTAGGCAGAAAAATGCAGAGG + Intronic
1157356489 18:46939900-46939922 TGTTAGTTTTAAAAATGAAGGGG - Intronic
1157837082 18:50914642-50914664 TGATAAGCTTTAAAATGCCAGGG - Intronic
1159477479 18:68942254-68942276 TGATAGGATCAAAGATGAAGGGG + Intronic
1160340750 18:78086940-78086962 TATGAGGCTTAAGAATGCAGGGG + Intergenic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
1165719499 19:38069117-38069139 TCAGAGGCTTAAAAATCCAGTGG + Intronic
1166344873 19:42159305-42159327 TGATGGACTGAAAAATGCATGGG - Intronic
926370746 2:12176377-12176399 TGAGAGCCTACAAAATGCAGAGG + Intergenic
926575731 2:14578686-14578708 TGATAGGCTCAAAGATGGTGAGG - Intergenic
926831679 2:16969669-16969691 TTATTTGCTTAAAAATGCTGTGG - Intergenic
927423971 2:22960501-22960523 AGATAGAACTAAAAATGCAGTGG + Intergenic
929914281 2:46121243-46121265 TAATAAGCTTAAGAATGCACAGG + Intronic
930472576 2:51837902-51837924 TGATAAGCTCAAAAATCTAGGGG + Intergenic
931190742 2:59997834-59997856 TGATAGAATTAAAAATGCTCAGG - Intergenic
932781635 2:74562216-74562238 TGATAGCCTTAAGAATGTGGAGG - Exonic
932869941 2:75388770-75388792 TGCTTGGCTTAAAAATGAACTGG - Intergenic
934924677 2:98373951-98373973 CCAAAGGCTTAAAAATGCATTGG + Intronic
935858894 2:107305458-107305480 TGCTTGGCTTAAAAAGGCACTGG - Intergenic
936653248 2:114454563-114454585 TGAGAGGCTTAAAATAGCAGGGG - Intronic
937342960 2:121103667-121103689 TGATTGGCTGGAAAATGCAGTGG + Intergenic
941252321 2:163181477-163181499 TATTAGACTGAAAAATGCAGTGG + Intergenic
941285931 2:163611790-163611812 TCTTAGGCTTGAAGATGCAGTGG - Exonic
945312717 2:208333603-208333625 TTATACCCTTATAAATGCAGAGG + Intronic
947951458 2:234151283-234151305 TGAGAGGCATAAAAATGAATGGG - Intergenic
1173637054 20:44569096-44569118 TGAAATCCTTAAAAATGTAGGGG - Intronic
1175852524 20:62101491-62101513 TGAGAGGCTCAAAAGTGCTGAGG + Intergenic
1176676475 21:9783445-9783467 TGATAAGCTTAATGATGAAGGGG - Intergenic
1177134919 21:17298225-17298247 TGATATGCCTCAAAATGGAGTGG - Intergenic
1178579231 21:33823632-33823654 TGTGAGGCTTAAAGATTCAGAGG + Exonic
1178678835 21:34654399-34654421 GAATAGGCTTCAAAGTGCAGTGG - Intergenic
1178795190 21:35737573-35737595 TGCTTGGCCTAAAAATGCATGGG + Intronic
1179309237 21:40182186-40182208 TGAAAGGTTTAACAATGGAGAGG + Intronic
1183267211 22:36835832-36835854 TAAAAGGGTTAAAATTGCAGAGG - Intergenic
1184487222 22:44787165-44787187 TGCTAGGCTTTAAAGAGCAGAGG + Intronic
949671839 3:6406367-6406389 TAATAGTCTTAAAAATGAATGGG + Intergenic
951291716 3:20878738-20878760 TGATAGACTTTAAAATACACAGG + Intergenic
951506130 3:23446771-23446793 TCAAAGACTTAAAGATGCAGGGG - Intronic
952108572 3:30096491-30096513 TGTTAGTCCTAAAAAGGCAGTGG + Intergenic
956442108 3:69290567-69290589 TGATAGGGATACAAATGCATGGG - Intronic
957800468 3:85072825-85072847 TGATTACCTTAAAAATGCAGAGG + Intronic
958445267 3:94207331-94207353 TGATACTCTTAAAAATTCTGGGG + Intergenic
958451185 3:94274885-94274907 TGATGTGTTAAAAAATGCAGAGG + Intergenic
959134007 3:102393924-102393946 TGATAGGTTGAAAATTGCTGTGG + Intronic
960284616 3:115813643-115813665 AAATAGGCTTAAAAATACAAGGG + Intronic
961950265 3:130742358-130742380 TCATAGGTTTAAAATTTCAGTGG - Intronic
963171715 3:142257772-142257794 TGAGAGGCTTAGTACTGCAGAGG + Intergenic
963195328 3:142521644-142521666 TGAGAGGCTCAAAATTTCAGTGG + Intronic
964941654 3:162164680-162164702 TGATAGGCTGAAATAAGCCGTGG - Intergenic
965312612 3:167149647-167149669 TGGAAGATTTAAAAATGCAGAGG - Intergenic
965632479 3:170747371-170747393 TTATAGCCTTAAAAATAAAGTGG + Intronic
965729587 3:171756585-171756607 TGCCAGGCTTAAGAATGCATAGG + Intronic
967084501 3:186081591-186081613 TCAAAGGCTTAAAATTGCTGTGG + Intronic
967722813 3:192833446-192833468 TGAGATGTTTAAAAATGAAGTGG - Intronic
970279667 4:14440624-14440646 AGACATGCTTAAAAATTCAGAGG + Intergenic
972133459 4:35863756-35863778 TGATATGCCTCAAAATGGAGTGG + Intergenic
973751778 4:54027328-54027350 TTTGAGCCTTAAAAATGCAGAGG - Intronic
973870353 4:55159951-55159973 TGAAAGGCTTAGATATGCAGTGG - Intergenic
975912748 4:79287396-79287418 TGATTGGCTTAAAATTGCTCTGG - Intronic
976152306 4:82104687-82104709 GGATGGGCTTCCAAATGCAGAGG - Intergenic
977035897 4:91952755-91952777 TTATAGGCTTTAAACTGCAAAGG - Intergenic
977785386 4:101027415-101027437 TGCTAACCTTTAAAATGCAGAGG - Intronic
979111160 4:116759137-116759159 TTATACTCTTTAAAATGCAGAGG + Intergenic
979630541 4:122897581-122897603 TAATTGGCTTAAAAATGTTGAGG - Exonic
982602629 4:157470643-157470665 TGTTTGGCTTAAAAATGAACTGG + Intergenic
983155985 4:164349334-164349356 TGAGAGGAATAAAAATGCAGAGG - Intronic
983575168 4:169253593-169253615 TCATAGGATTCAAAATGTAGAGG + Intronic
985399057 4:189575323-189575345 TGATAAGCTTAATGATGAAGGGG + Intergenic
985991803 5:3567989-3568011 TGATAGGTTTAAAAAGTCACTGG - Intergenic
986735531 5:10664968-10664990 TGTGAGGCTTAAAGATTCAGAGG - Intergenic
987780514 5:22428050-22428072 TTATAGCCTTAAAATTTCAGTGG + Intronic
987938195 5:24496870-24496892 TCATAGGCTGAAAAATGCCTCGG - Intronic
988698100 5:33644463-33644485 TTATTGACTTAAAAATTCAGTGG - Intronic
989552588 5:42753152-42753174 TGATAATCTTAAAAAGGCAAAGG + Intergenic
992365635 5:76086151-76086173 TGATAGGGTTAATAATGAATAGG - Intronic
994321736 5:98402605-98402627 TGTTAGTCTTAAGAATGAAGGGG - Intergenic
994365682 5:98914161-98914183 TCACAGCCTTAAAAATGAAGTGG + Intronic
994986117 5:106935933-106935955 TTATAGGCTGAAAAATGAAAAGG - Intergenic
1001803165 5:174560767-174560789 TGCTCTGCTGAAAAATGCAGAGG + Intergenic
1001850724 5:174962607-174962629 AGAGAGGCGTAAAAATGCTGTGG - Intergenic
1002305072 5:178278378-178278400 TGAAACCCTTAAAAATGCAAAGG + Intronic
1002950518 6:1805824-1805846 TGACAGTCTTAAAAATGCTGAGG - Intronic
1003095114 6:3136408-3136430 TGACTGGCTTAAATATTCAGAGG - Intronic
1003243643 6:4366200-4366222 TGATATGATGAACAATGCAGAGG + Intergenic
1003709172 6:8569681-8569703 TGATGTGCTTAAAAATGATGAGG + Intergenic
1007029842 6:38617770-38617792 TGATATGCCTCAAAATGGAGTGG - Intronic
1007667647 6:43524891-43524913 TGAAAGGCTTACAGATGCACGGG - Exonic
1008720266 6:54340981-54341003 TGATAGGCTTTCAAATGTGGAGG + Intronic
1008812381 6:55519053-55519075 GGATAAGCTTATAAATGAAGAGG + Intronic
1009576756 6:65473450-65473472 TTATAGCTTTAAAAATACAGTGG - Intronic
1009657054 6:66561082-66561104 TGATAGACAGAAGAATGCAGTGG - Intergenic
1011481809 6:87801334-87801356 TGATGGGCTTAACAATGAATTGG - Intergenic
1014755772 6:125301055-125301077 TGATAGGCTTCCAAATTCTGAGG + Intronic
1016520893 6:144945307-144945329 TGATGGGTTTGAAAATGCAAAGG - Intergenic
1017432293 6:154382813-154382835 TGGTCAGCTGAAAAATGCAGAGG - Intronic
1017749352 6:157476248-157476270 TGATACGATTAAAAATACAAAGG + Intronic
1018206148 6:161438905-161438927 TGAGAGGCTTAAAAAGGTAGGGG + Intronic
1020181389 7:5925138-5925160 TGATAGGCTCAAAACTCCTGAGG + Intronic
1020301544 7:6799752-6799774 TGATAGGCTCAAAACTCCTGAGG - Intronic
1021427047 7:20512326-20512348 TGAAATGCTTTAAAATGCATTGG - Intergenic
1021608136 7:22430154-22430176 TGAAAGTTTTAAAAATACAGTGG + Intronic
1022813869 7:33895272-33895294 AGAAATGCTAAAAAATGCAGAGG + Intergenic
1023424883 7:40025201-40025223 TGATAGGCTTAAAAATGCAGTGG - Intronic
1024876240 7:54027137-54027159 TAATAGACTTAAATATGCATAGG + Intergenic
1029540793 7:101180769-101180791 TGAAAGGCTGAAAAGGGCAGAGG + Intergenic
1029888068 7:103894681-103894703 TAATATGCAGAAAAATGCAGAGG + Intronic
1033556078 7:142489440-142489462 TCATGGGCTTAAAAATTCGGTGG - Intergenic
1037106765 8:15118401-15118423 GGGGAGGCTTGAAAATGCAGTGG + Intronic
1039252907 8:35686355-35686377 AGACAGGCTTACAAAAGCAGTGG - Intronic
1040537312 8:48321732-48321754 TGATATGTTTCAAAATGCTGCGG - Intergenic
1040971658 8:53142202-53142224 TGATATGCCTAAAAATGGAGTGG + Intergenic
1042302837 8:67304127-67304149 TGATAGTGTTAAAAATGTATAGG - Intronic
1043012668 8:74900478-74900500 TGTTTGGCTTAAAAATGAACTGG + Intergenic
1043420986 8:80098478-80098500 TGAGAGGCTTAAGACTTCAGTGG + Intronic
1046029344 8:108765016-108765038 TGATAGGCTGAAAACGGAAGGGG - Intronic
1046453913 8:114434058-114434080 TGATAGTATTAAAAATACTGAGG - Intergenic
1047301523 8:123617631-123617653 AGAGAGGCTTAAAAATTAAGAGG + Intergenic
1048946592 8:139454072-139454094 AGGTAGGCCTTAAAATGCAGAGG + Intergenic
1052050694 9:23845466-23845488 TGAGAGGGGTAAAAATTCAGGGG + Intergenic
1052090905 9:24326229-24326251 TAATAAGCTTAAAAACCCAGTGG - Intergenic
1052107973 9:24543988-24544010 TGAAAGGCTGAGAAATGAAGAGG - Intronic
1052408702 9:28095364-28095386 AGATAAGCTTAAAAATGGAAGGG + Intronic
1058415040 9:104778585-104778607 TGGTTGTGTTAAAAATGCAGTGG - Intergenic
1059598818 9:115753496-115753518 TGTTCTGCTTAGAAATGCAGAGG + Intergenic
1059731961 9:117065733-117065755 AGATAGGCATAGAGATGCAGTGG - Intronic
1059870157 9:118563759-118563781 TGACAGGTTTAAAAAAGCAAAGG - Intergenic
1059955551 9:119511986-119512008 TGAGAGGCTTAAAAATGACTGGG - Intronic
1060126963 9:121056576-121056598 TGATAAACTGAAAAATGCACTGG + Intergenic
1060570908 9:124639251-124639273 TCATACAATTAAAAATGCAGGGG + Intronic
1186052353 X:5611653-5611675 AGATAGACTAAAAAATTCAGGGG - Intergenic
1187954152 X:24499195-24499217 TGGTAGTTTTAAGAATGCAGTGG + Intronic
1188634364 X:32410341-32410363 TGATAGGCTTAAAAAGTCCAGGG - Intronic
1188752549 X:33922420-33922442 TGTTTGGCTTAAAAATGAACTGG - Intergenic
1188929563 X:36089726-36089748 TGCTAGGCTTAATATTGGAGTGG + Intronic
1189223287 X:39391259-39391281 TGATGGTCTTAAAAATCCTGAGG - Intergenic
1189941971 X:46133871-46133893 TAATTGGCTTTAAGATGCAGGGG - Intergenic
1190439799 X:50465878-50465900 TAAAAGGGTTAATAATGCAGAGG + Intronic
1193257834 X:79370283-79370305 TGATTGGCATAAGAATACAGTGG + Intergenic
1193976522 X:88126750-88126772 TAAAAACCTTAAAAATGCAGAGG + Intergenic
1194930631 X:99882840-99882862 TGAAAAGCAGAAAAATGCAGGGG + Intergenic
1196127549 X:112115428-112115450 TGTTAGGCCTCAAAATGGAGGGG + Intergenic
1197553207 X:127920464-127920486 TGAAAAACTTAAAAAGGCAGAGG - Intergenic
1199891357 X:152085951-152085973 TGATAAATTTAAAAATGCACAGG + Intergenic
1201312244 Y:12607420-12607442 TGATATGCCTCAAAATGGAGTGG + Intergenic
1201407688 Y:13664971-13664993 TGATATGCCTGAAAATGGAGGGG + Intergenic
1201516145 Y:14820338-14820360 TGATATGCATCAAAATGGAGTGG + Intronic