ID: 1023426064

View in Genome Browser
Species Human (GRCh38)
Location 7:40037559-40037581
Sequence CTGTGTGACCAACAGAATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 1, 2: 3, 3: 18, 4: 158}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023426064_1023426067 3 Left 1023426064 7:40037559-40037581 CCAATATTCTGTTGGTCACACAG 0: 1
1: 1
2: 3
3: 18
4: 158
Right 1023426067 7:40037585-40037607 GTCCTTGAATCACTGTGGCGTGG No data
1023426064_1023426069 8 Left 1023426064 7:40037559-40037581 CCAATATTCTGTTGGTCACACAG 0: 1
1: 1
2: 3
3: 18
4: 158
Right 1023426069 7:40037590-40037612 TGAATCACTGTGGCGTGGCATGG 0: 1
1: 0
2: 1
3: 14
4: 134
1023426064_1023426070 24 Left 1023426064 7:40037559-40037581 CCAATATTCTGTTGGTCACACAG 0: 1
1: 1
2: 3
3: 18
4: 158
Right 1023426070 7:40037606-40037628 GGCATGGATGCCAGATAGTGAGG No data
1023426064_1023426065 -2 Left 1023426064 7:40037559-40037581 CCAATATTCTGTTGGTCACACAG 0: 1
1: 1
2: 3
3: 18
4: 158
Right 1023426065 7:40037580-40037602 AGACCGTCCTTGAATCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023426064 Original CRISPR CTGTGTGACCAACAGAATAT TGG (reversed) Intronic
903560897 1:24226123-24226145 CTGTGGGTTCAACAGACTATGGG + Intergenic
904964936 1:34364610-34364632 TTGTTTGACCAACAGAATCTGGG - Intergenic
906795718 1:48695087-48695109 CTGTGTCACTCAGAGAATATAGG + Intronic
907919339 1:58898126-58898148 CTCTGTAACCAACTTAATATGGG - Intergenic
909821321 1:80065694-80065716 CTGTGTAACAGAAAGAATATTGG - Intergenic
916833329 1:168515180-168515202 TTGTGTAACCAACAGACTCTAGG - Intergenic
917728492 1:177850476-177850498 CTGTGTGGCAAACAGAGTAAAGG + Intergenic
917873843 1:179267294-179267316 CTGTGTAATCAATAGAATATGGG - Intergenic
918623784 1:186635123-186635145 CTTTGTGACCAATAGAAAGTAGG + Intergenic
918748747 1:188242782-188242804 CTGTGAGACAAACAGATTTTGGG + Intergenic
920078273 1:203352875-203352897 CTGTGTGACCCACATTATAATGG - Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
924791716 1:247256653-247256675 CTGTATGACAAACAGAAGACTGG - Intergenic
1063570720 10:7212256-7212278 CTGTTTGGCCAACCGAATTTGGG - Intronic
1063832778 10:9974846-9974868 CTGGGTGAACAACAAAATATGGG + Intergenic
1064428067 10:15247581-15247603 CTGTGTGACCAACAGCCTAATGG + Intronic
1064897115 10:20249754-20249776 CTCTGTGCTCAACAGAATAATGG - Intronic
1066059559 10:31709686-31709708 CTGTGAGTCCATCAGAAGATAGG + Intergenic
1066995322 10:42557247-42557269 CTGTCTGAACAACAGAAAAAAGG + Intergenic
1067770947 10:49124756-49124778 CTGTGTGACAATTAGAACATAGG + Intergenic
1067956600 10:50797861-50797883 TTTTGTGACCTACAGAATAATGG - Intronic
1070201066 10:74207030-74207052 GTGTGTGAGCAAGCGAATATGGG + Intronic
1072528130 10:96292817-96292839 CTGTGTAAACTACAGAATTTGGG - Intergenic
1074020501 10:109577694-109577716 CTGTGTCACCCAAATAATATGGG + Intergenic
1076177198 10:128377237-128377259 CTGTGTGACCAGCAGCCTGTTGG + Intergenic
1076506184 10:130974029-130974051 TTTTGTGTCCAACAGAATTTAGG - Intergenic
1077761658 11:5106676-5106698 CTGTCTGACCAACTGTAAATAGG - Intergenic
1077777866 11:5291614-5291636 TTCTGTGACCAACAGACTGTGGG + Intronic
1080575305 11:33593485-33593507 CTGTGTGGCAAACAGACTGTAGG + Intronic
1081152137 11:39645865-39645887 CAGTGTGGTAAACAGAATATTGG - Intergenic
1082714270 11:56592961-56592983 ATGTCTGAACAACAGAATAAAGG + Intergenic
1082873209 11:57962552-57962574 CTGTGTGATCAGAAGAAAATTGG - Intergenic
1083956586 11:65987281-65987303 CATTCAGACCAACAGAATATAGG - Intergenic
1085481412 11:76825665-76825687 CTCTGTGACTGACTGAATATGGG + Intergenic
1086560830 11:88167229-88167251 CTGTGTGAGCCACAGCATAAAGG + Intronic
1089121270 11:116137334-116137356 CTTTGTGACCAACAAAAGAGGGG + Intergenic
1091191676 11:133701013-133701035 CTGGGTGACCCTCAGAGTATTGG + Intergenic
1095813100 12:46392432-46392454 CTGTGCTACCCAAAGAATATAGG + Intergenic
1096911021 12:54983867-54983889 CTCAGTGACCTACATAATATTGG - Intronic
1101063031 12:100991063-100991085 CAGTGGGACCAAGAGAATAGAGG + Intronic
1110087734 13:71403635-71403657 TTATGTGACCAATAGGATATAGG - Intergenic
1112218826 13:97465935-97465957 CTGTGAAACCAACAAAATGTGGG - Exonic
1112407566 13:99134793-99134815 CTTTGTGGCCAACAGACCATCGG + Intergenic
1112472429 13:99701146-99701168 CTCTGTGACCAAAAGTACATAGG + Intronic
1113865483 13:113519678-113519700 CTGTGTGACCAACACAGACTTGG - Intronic
1115857551 14:37647281-37647303 CTGTGTGGACAATAGATTATAGG + Intronic
1116317590 14:43417632-43417654 CTGTCTGCCCCACAGAATACAGG + Intergenic
1118070278 14:62239108-62239130 CTCTCTGAGCATCAGAATATTGG - Intergenic
1118516342 14:66532469-66532491 CTATTTGACCAACAGAATAATGG - Intronic
1119108094 14:71943296-71943318 ATGTGTGACCATGAGAATAGAGG + Intronic
1119355727 14:74004816-74004838 CTGTATGAGCATTAGAATATAGG - Intronic
1119533122 14:75377335-75377357 GTGTCTTAGCAACAGAATATTGG - Intergenic
1120106271 14:80498849-80498871 CTGGTTGAACAACTGAATATAGG + Intronic
1123780925 15:23627591-23627613 CTGTGTGCCCAAGAGAAAACAGG - Intronic
1124176975 15:27435552-27435574 GTCTCTGACCACCAGAATATAGG + Intronic
1124458302 15:29864895-29864917 CAGTTTTACCAACAGAATATAGG - Intronic
1128464952 15:67902690-67902712 CTGTGTGACCGCCACAACATTGG - Intergenic
1132177984 15:99730849-99730871 CTGTGTGGCTTACAGAACATGGG - Intronic
1133084960 16:3355133-3355155 GTGTGTAACCAACAGTAGATGGG + Intergenic
1135326075 16:21526601-21526623 CTCTGTGCCGACCAGAATATCGG - Intergenic
1137582999 16:49645614-49645636 CTCTGTGACCAACAGGATTTTGG - Intronic
1138457424 16:57129378-57129400 CTGTGTGACCAAGTGAGTGTGGG + Intronic
1139829787 16:69788027-69788049 CTGTGTGACCAACAGACTGAAGG - Intronic
1140122468 16:72095497-72095519 GTGAGGGACCAACAGTATATAGG + Intronic
1140221448 16:73047565-73047587 CTGTGTGCCCAGCAGAATTTAGG + Intronic
1140292141 16:73669479-73669501 CTGTGTGACCAAAAGACTCAGGG + Intergenic
1141399207 16:83732515-83732537 TTCTGTGAGCAACAGAATAGAGG + Intronic
1142039113 16:87881326-87881348 CTCTGTGCCGACCAGAATATCGG - Intergenic
1147926419 17:43949004-43949026 TGCTTTGACCAACAGAATATGGG + Intergenic
1150965784 17:69966635-69966657 AATTGTGACCAACAGAATGTGGG - Intergenic
1155564000 18:27112719-27112741 CTGCATGACTAACAAAATATAGG - Intronic
1156688367 18:39676744-39676766 CTAGGTGATCATCAGAATATGGG + Intergenic
1157911285 18:51619518-51619540 GTGTGTGACCAACTGTGTATGGG - Intergenic
1160278349 18:77461415-77461437 CTGTGTGAAGAACAGAAACTAGG - Intergenic
1160891500 19:1381005-1381027 CTGTGTGACCAACAGAATGGCGG - Intergenic
1163569630 19:18073266-18073288 CTGTGTGAGAAACAGAGTGTGGG - Intronic
1163894253 19:20043658-20043680 CTGTGTAAACAACTGAATTTTGG - Intergenic
1165404150 19:35619716-35619738 CAGCGTGCCCAACAGAATGTGGG - Exonic
1166295076 19:41884905-41884927 CTGTGTGTCAAATAGAATCTGGG + Intronic
1166783480 19:45354202-45354224 CTGGGTGACCAGCAGGACATGGG - Intronic
926903304 2:17781474-17781496 CTGTGTTACTGACAGAATAAGGG - Exonic
930109749 2:47668394-47668416 CTGTGTTACAAACAGACTAGAGG + Intergenic
930910946 2:56629109-56629131 CTTTGAGACAAACAGAATATAGG + Intergenic
931115417 2:59161459-59161481 CTGTGTGACCTCCAAAATCTAGG - Intergenic
931980984 2:67694007-67694029 GTGTGTGTCCAAAAGACTATAGG + Intergenic
935390774 2:102550623-102550645 CTATCTGACCAACAAAAAATGGG + Intergenic
936932273 2:117802270-117802292 CTGGGTGACCAATTGGATATGGG - Intergenic
936991110 2:118367086-118367108 CCAAGTGCCCAACAGAATATAGG - Intergenic
938845548 2:135205209-135205231 CTGTGTGCCCACTAAAATATTGG - Intronic
938888733 2:135680876-135680898 TTGTGTGAGTAACAGAAGATTGG - Intronic
940320442 2:152371180-152371202 TTGTGTTATCAGCAGAATATTGG - Intronic
941248883 2:163136385-163136407 CTTTGTCACCAACAGAAATTAGG + Intergenic
942623892 2:177878097-177878119 CTGTGTGACCAGATGAATGTAGG + Intronic
943285374 2:185991751-185991773 CTGTGTGACCCATAGAATACAGG - Intergenic
944478228 2:200128263-200128285 CTGTGTGGCCAGCTAAATATTGG - Intergenic
945176903 2:207052379-207052401 CTGTGTGTCCCAGAGAAGATGGG - Intergenic
1169619029 20:7483847-7483869 CAGTGTGAACAACAGTATTTTGG - Intergenic
1170880241 20:20290604-20290626 CTGTGTAGCCAACAGGATATTGG + Intronic
1170944633 20:20880145-20880167 CTGTGAGTCCAGTAGAATATGGG - Intergenic
1172026302 20:31951351-31951373 CTGTGTGGAATACAGAATATAGG - Intronic
1173012818 20:39197718-39197740 CTGTGTTATGAACTGAATATTGG + Intergenic
1173289087 20:41698702-41698724 CTGTGTCACCAGCAGAATGCAGG + Intergenic
1175452259 20:59079463-59079485 CTGTGTGACCATCATAGTGTTGG - Intergenic
1176126159 20:63475798-63475820 CTCTGTGACCAGCACCATATGGG - Intergenic
1183855625 22:40632005-40632027 ATGTGTGGCCAACAGAATACTGG + Intronic
1184756314 22:46517862-46517884 GTGTGTAATAAACAGAATATGGG - Intronic
1185286431 22:50001925-50001947 CTGTCTCACCAACAGCATGTGGG - Intronic
949597895 3:5566904-5566926 CTGTTTGACCAATCGAATATTGG + Intergenic
949997309 3:9628406-9628428 CTGTGTAACTAATAGAATACAGG - Intergenic
951261823 3:20518706-20518728 CTATGTGACCAATAGTGTATAGG + Intergenic
952057440 3:29464878-29464900 CTGTATCAATAACAGAATATTGG + Intronic
953004673 3:38967253-38967275 GTGTGTAAACAATAGAATATTGG + Intergenic
954225681 3:49179469-49179491 CTGTGAGACCCACATGATATTGG + Intronic
956081100 3:65557169-65557191 CTGGATGACTAATAGAATATAGG + Intronic
957012177 3:75019862-75019884 CTGTGTGCCCAAGAGGCTATTGG + Intergenic
957139978 3:76341659-76341681 GATTCTGACCAACAGAATATTGG - Intronic
957986650 3:87580592-87580614 GTTTCTGAACAACAGAATATAGG - Intergenic
960592392 3:119378625-119378647 CTGTGTGCACAGCAGAATGTGGG + Intronic
961003265 3:123388306-123388328 CTGTATGACCAACTGAAAGTGGG + Intronic
961243675 3:125433707-125433729 CTGTGTGACCCAGAGAGCATGGG + Intergenic
962695701 3:137945230-137945252 ATGTGTGACCAACAGGATGGAGG + Intergenic
968361701 3:198151858-198151880 CTGTGTGAGCAACAGAAGGAAGG - Intergenic
969466469 4:7360163-7360185 CTCTGTGCCCCACAGAATACCGG + Intronic
969474792 4:7415645-7415667 CTGTGTGTTCAACAAAATAAAGG - Intronic
972956558 4:44399586-44399608 CTGGGGGACCAACAGGATTTGGG - Intronic
973819871 4:54653388-54653410 CTGTGTGACCAAAAGTATTGTGG - Intergenic
978362576 4:107946940-107946962 CTGTGTGACCAAGAGAGTAAGGG - Intronic
979580322 4:122351012-122351034 CTGTGTGAAGAACAGACTATAGG + Intronic
982608262 4:157540390-157540412 CTGTCTCTCCAACAGCATATAGG + Intergenic
984154964 4:176185298-176185320 CTGAGTGACCTACAGAGTCTGGG - Intronic
986279358 5:6311015-6311037 CTCTGTGGCCAACAGAAACTGGG + Intergenic
986859528 5:11910362-11910384 CAATATGTCCAACAGAATATAGG + Intergenic
988050469 5:26023002-26023024 CTGTATGACACCCAGAATATGGG - Intergenic
991994563 5:72374524-72374546 CTATGTGACCAATAAGATATTGG + Intergenic
993104446 5:83583288-83583310 CTGTGGGATGAACAGAATACTGG + Intergenic
993520383 5:88892243-88892265 CTGTGTGGCCAACAGCCAATTGG + Intronic
997283810 5:132664471-132664493 CTGTGTGGCCAACAGGCCATCGG - Intergenic
999136668 5:149324945-149324967 CTGTGTAACCATTAGGATATTGG - Intronic
1000244569 5:159438760-159438782 CTGTGTGAAAAATAGAATGTAGG + Intergenic
1005012430 6:21348604-21348626 CTGTGAGACCAGCAGAAGCTCGG - Intergenic
1005529308 6:26686693-26686715 CTGAGTGACCAACTGAATGAAGG - Intergenic
1005541488 6:26814953-26814975 CTGAGTGACCAACTGAATGAAGG + Intergenic
1009584360 6:65578911-65578933 CTGTGTGACCATAAGAGAATGGG - Intronic
1009825417 6:68859873-68859895 CTATGTAAACAACAAAATATTGG - Intronic
1011573170 6:88762258-88762280 CTGTCTGACCCACGGAATAAGGG + Intronic
1012658649 6:101857947-101857969 CCCTGAGACCAACATAATATTGG - Intronic
1016009637 6:139126073-139126095 CTAGGTGATCAACAGCATATAGG + Intergenic
1018413794 6:163583576-163583598 CTGTGTGACCTCCAAAATAGTGG - Intergenic
1018564312 6:165135809-165135831 CTGTGTCACTAACAGCATTTTGG - Intergenic
1019232389 6:170578865-170578887 CTGTGGTGCCAAGAGAATATTGG - Exonic
1023426064 7:40037559-40037581 CTGTGTGACCAACAGAATATTGG - Intronic
1024012220 7:45278617-45278639 CTCTGTGCCACACAGAATATTGG - Intergenic
1027890757 7:83970850-83970872 CTGTGTTACCAAGAGTTTATGGG - Intronic
1028728008 7:94111010-94111032 CTGTTTGACCAACAGAATATGGG + Intergenic
1029100582 7:98126591-98126613 CGGTGTGGCCAAAAGAATGTCGG - Intronic
1029951979 7:104595909-104595931 CCTTGGGAACAACAGAATATTGG + Intronic
1030724736 7:112913494-112913516 CTGTGTTAAGAACAGACTATAGG - Intronic
1030801227 7:113855748-113855770 CTGTGTGTCCAAAAGAAAATAGG + Intergenic
1032552416 7:132796898-132796920 CTTTGTGACCAAGTGGATATGGG - Intronic
1035014246 7:155750862-155750884 CTGTGTGGCCAACAGAATAAAGG - Intronic
1039230756 8:35445096-35445118 CTCTGATACCAACAGAATAATGG - Intronic
1039712183 8:40067163-40067185 ATCTGTGACCCACAGAACATTGG - Intergenic
1042019093 8:64350907-64350929 CTGTTTGACCTACAAAATAACGG - Intergenic
1044345199 8:91096869-91096891 CTGTGTTACCAACAAACAATAGG + Intergenic
1047075976 8:121403495-121403517 CTGTTTGACCAACAGGACAATGG + Intergenic
1047199727 8:122755089-122755111 CTGTGTGGGAAACAGAATAAGGG - Intergenic
1047334834 8:123925528-123925550 CTGTGTGCCCAGCTGAAAATTGG + Intronic
1048333041 8:133484134-133484156 CTGGGTGGTGAACAGAATATGGG + Intronic
1048507577 8:135034927-135034949 CTGTGTGTACAACAGAGCATGGG - Intergenic
1050608618 9:7327815-7327837 TTGTGTAACCAACAGAATATGGG + Intergenic
1051522723 9:18008180-18008202 CTGTGTGACCCTCAGAAAATAGG + Intergenic
1053195745 9:36117081-36117103 CTGTGTCACAAACAGGATCTTGG - Exonic
1057612218 9:96555185-96555207 CTGTGTAACGAACAGGATACTGG + Intronic
1060692969 9:125681227-125681249 TGCTTTGACCAACAGAATATAGG + Intronic
1185692571 X:2168361-2168383 CCGTGTGACCAACAGTCTGTTGG - Intergenic
1186124139 X:6394497-6394519 CTGTGGCATCAACAGAACATAGG + Intergenic
1188573094 X:31613229-31613251 CTGATTGACAAATAGAATATGGG + Intronic
1194587548 X:95754676-95754698 CTGTGTACCCAACAAATTATTGG - Intergenic
1196483212 X:116175338-116175360 CTGTGTGAACAACAGCAGAGAGG - Intergenic
1196521433 X:116677860-116677882 CTATTTGACCAACAAAATTTTGG - Intergenic
1199493448 X:148426742-148426764 CTCTGTGTCCAACATAATAAAGG - Intergenic