ID: 1023431514

View in Genome Browser
Species Human (GRCh38)
Location 7:40096385-40096407
Sequence ACACCATTACAGTTTAAATA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023431514 Original CRISPR ACACCATTACAGTTTAAATA AGG (reversed) Exonic
902611178 1:17597922-17597944 TCACCTTTACAGTTTACATGGGG + Intronic
904105153 1:28074225-28074247 CCACCATTTCAATTTAAATAAGG - Intronic
904109218 1:28112358-28112380 AAACCATTGCAGTCTACATACGG + Intergenic
905714232 1:40134261-40134283 AAACCATGACAGGTTGAATATGG + Intergenic
906002235 1:42436639-42436661 ACAACATTCCAATTTAAAAATGG + Intronic
906348938 1:45040138-45040160 ACAGCTTTAGAGTTTAAAAATGG + Intronic
906762155 1:48385367-48385389 AAACAATTAAAGTTTAAATTTGG + Intronic
907724173 1:57003315-57003337 AAACTTTTACAGTTTATATACGG + Intronic
908812160 1:67993031-67993053 ATACCATGCCAGTTTACATAAGG - Intergenic
908919687 1:69174468-69174490 AGACTAATACATTTTAAATATGG - Intergenic
909130552 1:71730826-71730848 ACACCCCTACAGTTTTCATAGGG + Intronic
911634277 1:100216245-100216267 ACATCATTAAAGTTTCAAAATGG + Intronic
911708101 1:101038767-101038789 ACACAATTGCAGTGTAAAGATGG - Intergenic
912785767 1:112602529-112602551 ACATCCTTACAGTAAAAATAAGG + Intronic
913442407 1:118911881-118911903 ACACTTTTACAGTGTGAATAGGG - Intronic
916226645 1:162495743-162495765 GCACCATTACAATTTACAAATGG - Intergenic
916317187 1:163462414-163462436 ACACCTTTACATTTAAAAGAAGG - Intergenic
917560012 1:176141171-176141193 ACACCATTACACTTTCAATGGGG + Intronic
919509566 1:198444986-198445008 CCACCCTCATAGTTTAAATAAGG + Intergenic
919713162 1:200748327-200748349 CCACAATTACATTTTAAAAAGGG - Intronic
922427236 1:225510126-225510148 ACACAATGTCAGTTTAAAAACGG + Intronic
923847293 1:237749003-237749025 ACACTATAACATTTTATATAAGG + Intronic
924073748 1:240310585-240310607 AAATCATTACAGTTTATTTAGGG + Intronic
924523949 1:244829830-244829852 AAACCATTACAATACAAATATGG + Intergenic
1062825598 10:566185-566207 CTACGATTACAGTTTAAAAAGGG - Intronic
1062825602 10:566244-566266 CTACGATTACAGTTTAAAAAGGG - Intronic
1064272287 10:13876455-13876477 ACAGAATTACATTTTAAATAGGG - Intronic
1065076656 10:22086594-22086616 ACACCATTTTAGTTTATAGATGG - Intergenic
1065394929 10:25224935-25224957 ACACCTCTACAGTTTAAACTTGG - Intronic
1071519733 10:86322111-86322133 TCATCATTAAAGTTTAAAAAGGG + Intronic
1074526387 10:114266841-114266863 ACCACATTAACGTTTAAATATGG + Intronic
1075049987 10:119176417-119176439 AAACCATTACATATTAAATACGG + Intronic
1075215057 10:120525358-120525380 ACTCTATTACAGTATAAAAAGGG + Intronic
1075977709 10:126710345-126710367 CCAACACTACAATTTAAATACGG + Intergenic
1079393406 11:20041486-20041508 GCACCATTACAGTTTGATTGGGG + Intronic
1079695761 11:23480579-23480601 AAAGCATGAGAGTTTAAATAGGG - Intergenic
1084090462 11:66876149-66876171 ACAACGATACAATTTAAATAAGG + Intronic
1086921399 11:92591562-92591584 AAAACATTACAGGTAAAATAAGG - Intronic
1089844272 11:121446209-121446231 ACATCATTACAATTTAGAAAAGG + Intergenic
1091474191 12:755083-755105 ACACCACTAGAGGTTAAAAAAGG - Intronic
1092651588 12:10640885-10640907 ACAGCATCAGATTTTAAATATGG + Intronic
1092876556 12:12853657-12853679 ACACCATAAAAGATAAAATATGG - Intergenic
1093234962 12:16598339-16598361 ACAAACTTTCAGTTTAAATAAGG + Intronic
1094413661 12:30194816-30194838 ACTCCATTACAATTTCAATATGG + Intergenic
1094659665 12:32456231-32456253 ACACTATTACAGTGAAAAAATGG - Intronic
1096335927 12:50756323-50756345 ACACAATTAGAATTTAAATAGGG + Intergenic
1097429255 12:59483708-59483730 AAACCATTATAGTTTTAATTGGG - Intergenic
1098398166 12:70044193-70044215 AAACCCTTACAGATTAATTAAGG - Intergenic
1100763900 12:97841970-97841992 ATAAAATTACAATTTAAATAAGG - Intergenic
1101356996 12:103989019-103989041 AAACTATTACATTTAAAATATGG - Exonic
1104154665 12:126119608-126119630 ACATTTTTACAGTTTAAAAATGG + Intergenic
1106201563 13:27542074-27542096 ACATCATTACAGCTGAAATGAGG + Intergenic
1110205409 13:72906431-72906453 TGAACATTTCAGTTTAAATATGG - Intronic
1111013241 13:82340229-82340251 ACAATATTACTTTTTAAATAAGG + Intergenic
1112843007 13:103603049-103603071 AAACCATTACAATTTAAAAATGG + Intergenic
1114337322 14:21704152-21704174 AAACCACAACAGTTTTAATAAGG - Intergenic
1118153432 14:63214378-63214400 GCACCATTACAGCATAAAGAAGG - Intronic
1118343925 14:64920310-64920332 AGACCATAACAGCTTAAAGAAGG - Intronic
1118667264 14:68084537-68084559 ACACAACTGGAGTTTAAATATGG + Intronic
1118699626 14:68420568-68420590 ACATCATGACAGTTTACAAATGG - Intronic
1127203604 15:56687255-56687277 ACATTATGACATTTTAAATAAGG - Intronic
1128816570 15:70614062-70614084 ACACCATTTCAGTTAATTTAGGG + Intergenic
1132377816 15:101342230-101342252 ACACCATTACAGCACAAATGAGG + Intronic
1138840096 16:60490673-60490695 ACCCCATCACCATTTAAATATGG - Intergenic
1138894276 16:61183869-61183891 ACACTATTGATGTTTAAATATGG - Intergenic
1140060298 16:71563533-71563555 ACAGCTTTACTTTTTAAATATGG + Intronic
1140782536 16:78309727-78309749 ACAGCATTCCAGTTTAATTCTGG - Intronic
1144243790 17:13341710-13341732 ACACCATTACAGTTTAGCCTGGG - Intergenic
1155256951 18:24006659-24006681 ACACCTTTAGAGTTCAGATATGG - Intronic
1156007592 18:32461994-32462016 ACTGCATTATAGTTTAAAGAGGG - Intronic
1156978630 18:43258323-43258345 ACACCAAGAGAGTCTAAATATGG + Intergenic
1161129107 19:2577814-2577836 ACACCATAACATTTTATATAGGG - Intronic
1164144259 19:22501140-22501162 ACACAGTTACTGTTGAAATAAGG - Intronic
1164954778 19:32372856-32372878 ACAGCACCACAGTTTAGATATGG - Intronic
1167782423 19:51607759-51607781 ACACCATGACAGGACAAATAAGG + Intergenic
924966621 2:82333-82355 ACACTATTAATGTCTAAATAGGG + Intergenic
926454792 2:13053751-13053773 ACATATTTACAGTTTAAAGATGG + Intergenic
927998522 2:27503949-27503971 ACATATTTACATTTTAAATATGG + Intronic
929005509 2:37389445-37389467 ACACTGTTACATTTTATATAGGG - Intergenic
930755895 2:54971816-54971838 ACACTATTGCTCTTTAAATATGG - Exonic
931469893 2:62528889-62528911 TCACCATGACAGCTAAAATAAGG - Intergenic
933424386 2:82091222-82091244 ACATTAGTAAAGTTTAAATAAGG - Intergenic
934789773 2:97049038-97049060 ATACCATTACTGTTAGAATATGG - Intergenic
934816695 2:97333501-97333523 ATACCATTACTGTTAGAATATGG + Intergenic
934821001 2:97374983-97375005 ATACCATTACTGTTAGAATATGG - Intergenic
936470299 2:112792645-112792667 GCACCATGACAGTTTACAGATGG + Intergenic
937532936 2:122852217-122852239 ACAACATTACAGTTAAAGCATGG - Intergenic
942571231 2:177316540-177316562 ACAACATTTCAGTTCAACTACGG + Intronic
943476348 2:188361558-188361580 ACATCATTACAGAAAAAATATGG + Intronic
944085054 2:195836157-195836179 ACACCATTACTATTTGATTAGGG + Intronic
1170834709 20:19874248-19874270 TCAACATTACATATTAAATAAGG + Intergenic
1172100472 20:32482087-32482109 ACACCATTTCAGGTGAAATCAGG + Intronic
1176788972 21:13295725-13295747 GCACCATTATAGTATAATTATGG + Intergenic
1177988133 21:28003891-28003913 GCACCATTATAGTGTAATTATGG + Intergenic
1179389521 21:40974949-40974971 ACTCCCTTACAATTTAAAAAGGG - Intergenic
949375726 3:3388331-3388353 ACACGATTAAAGTTCAAATATGG + Intergenic
950961310 3:17110992-17111014 ACATCATTATTATTTAAATAAGG + Intergenic
951188893 3:19746485-19746507 CATTCATTACAGTTTAAATATGG - Intergenic
954886490 3:53879614-53879636 AGATATTTACAGTTTAAATATGG + Intronic
955453374 3:59094482-59094504 GCCCCATTATAGGTTAAATAGGG + Intergenic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
957148411 3:76453890-76453912 ACTCTATTACAGATAAAATAAGG + Intronic
958085845 3:88805258-88805280 ACACAATTAAAGTAAAAATATGG + Intergenic
959144271 3:102525090-102525112 TCTCCATTCCAGTTTGAATAAGG + Intergenic
959674801 3:109022161-109022183 AGATCATGACAGTTTATATAAGG + Intronic
960268841 3:115652266-115652288 AAATAATTACTGTTTAAATATGG - Intronic
962102132 3:132353747-132353769 ACATTATTACAATTTAAAGATGG - Intronic
962253646 3:133855484-133855506 ACACCTTCAAATTTTAAATAAGG + Intronic
962594260 3:136923817-136923839 AAACAATTACATTTTAAAAAGGG + Intronic
964242502 3:154613211-154613233 ATAAAATTACAATTTAAATATGG + Intergenic
964289262 3:155157645-155157667 AGATCATTACATCTTAAATAAGG - Intronic
964845352 3:161039004-161039026 GCACCATGACAGTTTACAAATGG + Intronic
966213606 3:177478326-177478348 GCACTATTACAGTCTAAAGAGGG - Intergenic
969901280 4:10352188-10352210 ACACTATGACACTTTACATAAGG - Intergenic
970253943 4:14147227-14147249 ACAGCATTAAAGTTAATATATGG - Intergenic
970417221 4:15871268-15871290 ACACCAGTAAAATTGAAATAGGG - Intergenic
970715530 4:18917801-18917823 ACACCATTACATAATAAAAAAGG + Intergenic
970797163 4:19926647-19926669 ACTCCATTCCAGTTGAAGTATGG + Intergenic
973681230 4:53322353-53322375 GCACCATGACAGTTTACAAATGG + Intronic
976627340 4:87200305-87200327 ATACCATACCAGTTTATATAAGG - Intronic
978428335 4:108605425-108605447 ACTCCATAACAGTTTTCATATGG - Intergenic
978943600 4:114467741-114467763 ACATCATGACAATTTAAAAAAGG + Intergenic
979507791 4:121517732-121517754 TCACCATTACAGTTTACTTTTGG + Intergenic
979903189 4:126249764-126249786 ACACCATTACCCATGAAATAGGG + Intergenic
980299828 4:130974971-130974993 ACACCTTTACCGTTTTATTATGG - Intergenic
982139674 4:152305657-152305679 ACACCATTTTAGTTTCAAAACGG + Intergenic
982903736 4:161042221-161042243 AAATCTGTACAGTTTAAATATGG - Intergenic
983850892 4:172579764-172579786 ACAACTTTAGAGTTTAAATGAGG + Intronic
985103583 4:186481310-186481332 ACGCCATTAAATTTTTAATAAGG - Intronic
985133229 4:186759662-186759684 ACACCCTTACAGTTTACAAGAGG - Intergenic
986289993 5:6392139-6392161 ACAACATGACACTTTATATAAGG - Intergenic
990183290 5:53186258-53186280 ACACCATTATTTATTAAATAGGG + Intergenic
990660021 5:58002863-58002885 TCACCATTTCATTTTAGATATGG + Intergenic
992061014 5:73047668-73047690 ACACTATGACAGTTTATGTAAGG - Intronic
993440555 5:87951744-87951766 CCATAACTACAGTTTAAATAAGG + Intergenic
994503864 5:100614961-100614983 ACATAATTACAGTCTAAATTTGG + Intergenic
994844446 5:104969137-104969159 ACACAAATACATTTTAAAAAAGG - Intergenic
995805792 5:116051080-116051102 ACAACATTACTGTGTACATATGG + Intronic
996201281 5:120677544-120677566 AAACAATCACAATTTAAATATGG - Intronic
996793709 5:127320913-127320935 ACATCTGTACAGTGTAAATATGG + Intronic
997269561 5:132525538-132525560 ACCCCATTCCAGTTTACAGATGG + Intergenic
997514106 5:134473978-134474000 ACACCATATCAGTAGAAATAAGG - Intergenic
998276313 5:140757328-140757350 GAACCATTTCAGATTAAATAGGG - Intergenic
1002083565 5:176753104-176753126 AGACCATTTCAGTTTGTATACGG - Intergenic
1003721150 6:8703775-8703797 ACATCTTTACAATTTAAATCTGG + Intergenic
1005732254 6:28709534-28709556 ACACCATCAGCATTTAAATAGGG - Intergenic
1007025192 6:38564151-38564173 ACACGAATACAGTTTAAACTGGG - Intronic
1008202909 6:48614590-48614612 ACAAGATAACATTTTAAATAGGG - Intergenic
1008701632 6:54107358-54107380 ATTCCATTACAGTCTAAATTTGG - Intronic
1010380771 6:75222367-75222389 ACAGCATTGCAGTTTACTTAAGG + Intergenic
1013264282 6:108479404-108479426 CCACAATTACAGTCTAGATAAGG - Intronic
1013832158 6:114286115-114286137 ACAGCATTACATGTTAATTATGG - Intronic
1017037910 6:150283714-150283736 ACACAATTACATTTTAATAAAGG + Intergenic
1017347418 6:153400407-153400429 TCACCAGTACATATTAAATAAGG + Intergenic
1018139300 6:160812009-160812031 TCACCAGTACATATTAAATAAGG - Intergenic
1018150078 6:160929823-160929845 AAACCAATGCAGTTAAAATACGG - Intergenic
1021235205 7:18135154-18135176 ACTTCATTACATTTTAAATGGGG - Intronic
1022138711 7:27473804-27473826 GCACCTTTACAGATTATATAGGG + Intergenic
1022280069 7:28899232-28899254 ACACCTTTAGAGTATTAATAAGG - Intergenic
1023431514 7:40096385-40096407 ACACCATTACAGTTTAAATAAGG - Exonic
1027375560 7:77545516-77545538 ACATAATTACAGTTTGAAAAAGG - Intronic
1028288763 7:89039207-89039229 ATGCCATTACAATTTTAATAGGG + Intronic
1028323979 7:89498965-89498987 ATACCATTACACCTTAAAAAAGG - Intergenic
1029817951 7:103115949-103115971 TCACCATGACAGTTTATAAATGG - Intronic
1029887392 7:103887742-103887764 ACACCAAAACACTTTAATTAGGG - Intronic
1029961960 7:104697099-104697121 ACTCCATTTCATTATAAATAAGG + Intronic
1031599170 7:123684346-123684368 AAACCTTTACAGATTAAATGAGG + Exonic
1031658658 7:124392474-124392496 ACACCATTAAAATTAAATTAGGG - Intergenic
1032629758 7:133635992-133636014 ACTCCTTTCCAGTTGAAATAGGG - Intronic
1033612082 7:142973047-142973069 AGACCATTACATTATAATTATGG + Intergenic
1038964449 8:32555890-32555912 ACAATATTACACTTTAAAAAGGG - Intronic
1039859650 8:41446161-41446183 AAACAATTACATATTAAATAAGG + Intergenic
1041479210 8:58299422-58299444 GCACCATGACAGTTTACAAATGG + Intergenic
1043527169 8:81110061-81110083 AACCCTTTACACTTTAAATAAGG + Intronic
1045906927 8:107356828-107356850 ACAGCATCAGAGTTTTAATATGG + Intronic
1050103028 9:2138263-2138285 ATAGCATCACATTTTAAATACGG - Intronic
1050345049 9:4677907-4677929 ACAGCATTAGCGTTTATATAGGG + Intergenic
1051588804 9:18754943-18754965 ACAACAATTCAGTTAAAATAAGG + Intronic
1055758341 9:79579320-79579342 ACAGCATTACAGGTGAAAGATGG - Intronic
1055987393 9:82065045-82065067 ACATCATTAGAATTTAAACAGGG - Intergenic
1056339825 9:85616679-85616701 GCATCATTACAAGTTAAATAGGG + Intronic
1057534732 9:95889364-95889386 ATACCATAACAATTTAAATGAGG - Intronic
1058054105 9:100432436-100432458 ACATCATTACAGTTCAAAGAAGG - Intronic
1058773553 9:108262583-108262605 ACTCCCTTACAGTACAAATAGGG - Intergenic
1058989980 9:110246160-110246182 AAACCATTACAGTTAAAGTCGGG + Intronic
1059684291 9:116619829-116619851 ACAGTATAAAAGTTTAAATAAGG - Intronic
1186720842 X:12301886-12301908 TCATCATGGCAGTTTAAATAAGG + Intronic
1186885290 X:13907067-13907089 GCACAATTACAGATTAATTAGGG + Intronic
1187659085 X:21518269-21518291 ACACCCTTACACTTTGAAGAAGG - Intronic
1190006257 X:46741949-46741971 ACAACAGTACAATTTAAAAATGG + Intronic
1191006009 X:55712133-55712155 GCACCATGACAGTTTACAAATGG - Intergenic
1191887818 X:65906991-65907013 ACACCATTACATTCCAAATTAGG + Intergenic
1192605264 X:72509810-72509832 ACAACATTACAGTATTAAAATGG - Intronic
1193256684 X:79356649-79356671 CCACCATTACTCTTTATATAAGG - Intergenic
1195892099 X:109707120-109707142 AGACCCTTAGAGTTAAAATATGG + Intronic
1197568967 X:128125860-128125882 ACACCATTAAAATTTTAATAAGG - Intergenic
1197692258 X:129514745-129514767 AGACCATTAAAGGTTACATAAGG + Intronic
1197961996 X:132017169-132017191 ACCCCATTATAGTTTACATTTGG + Intergenic
1199669879 X:150135777-150135799 AGACAATTACATTATAAATAGGG + Intergenic