ID: 1023439502

View in Genome Browser
Species Human (GRCh38)
Location 7:40171435-40171457
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 121, 2: 130, 3: 79, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023439502_1023439509 24 Left 1023439502 7:40171435-40171457 CCTGAATGGAGTTCCTCCTAGGT 0: 1
1: 121
2: 130
3: 79
4: 81
Right 1023439509 7:40171482-40171504 TAAGATTTAAATCCCCTGTTAGG 0: 44
1: 137
2: 77
3: 55
4: 177
1023439502_1023439507 -3 Left 1023439502 7:40171435-40171457 CCTGAATGGAGTTCCTCCTAGGT 0: 1
1: 121
2: 130
3: 79
4: 81
Right 1023439507 7:40171455-40171477 GGTCTGGTTGGACCTTTGTATGG 0: 29
1: 88
2: 102
3: 71
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023439502 Original CRISPR ACCTAGGAGGAACTCCATTC AGG (reversed) Intronic
901599390 1:10410881-10410903 GCCTTGGAGGGACTCCTTTCTGG + Intronic
902031934 1:13429265-13429287 ATCTAGGAGGAACTCCCTTCAGG + Intergenic
902051812 1:13569112-13569134 ACCTAGGAGGAACACCCTTCAGG + Intergenic
904571290 1:31467742-31467764 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
904713121 1:32446639-32446661 ACCTAGGAGGAACTCCCGTCAGG - Intergenic
905567778 1:38979592-38979614 ATCTAGGAGGAACTCCCTTCAGG - Intergenic
906507574 1:46391627-46391649 ACCTAGGAAGAACTCCCTTCAGG - Intergenic
906582488 1:46947612-46947634 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
906583255 1:46953792-46953814 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
906601124 1:47130257-47130279 ATCTAGGAGGAACTCCCTTCAGG - Intergenic
906767031 1:48442987-48443009 ACCTAGAAGGAACTCCCTTCAGG + Intronic
907037233 1:51227291-51227313 ACCTAAGAGTAACTCTCTTCCGG + Intergenic
907505825 1:54917514-54917536 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
907602680 1:55786620-55786642 ACTTAGGAAGAATTCCCTTCAGG - Intergenic
908300893 1:62760172-62760194 CTCTAGGAGGAACTCCCTTCAGG + Intergenic
910396969 1:86803275-86803297 ACAGAGGAGGAACTCCCTTTAGG - Intergenic
910590743 1:88926303-88926325 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
911299194 1:96152040-96152062 ACCTAGGAGGAACTCCCTTAAGG + Intergenic
911751862 1:101504732-101504754 ATCTAGGAGGAACACCCTTCAGG + Intergenic
912815876 1:112827615-112827637 ACCTAGTAGGAACTCCCTGTAGG + Intergenic
916084140 1:161256251-161256273 ACCTAGGAAGAACTCCCTCCAGG + Intergenic
917227801 1:172802527-172802549 ATCTAGGAGGAACTCCCTTCAGG + Intergenic
917311932 1:173687873-173687895 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
917676592 1:177324454-177324476 ACCTAGGAGGAACTCCAGTCAGG + Intergenic
919257257 1:195140590-195140612 ATCTAGGAAGAACTCCCTTCAGG + Intergenic
919559176 1:199096359-199096381 ACCTAGGATGAACCCCCTTCAGG + Intergenic
920425370 1:205870842-205870864 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
924859216 1:247904142-247904164 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
924942976 1:248825252-248825274 TGCTAGGAGGAGCACCATTCGGG + Exonic
1064322292 10:14316823-14316845 GCCTAGGAACAACTCCATCCTGG + Intronic
1064603081 10:17012884-17012906 ACATAGGAGGAGCTCCCTTCAGG - Intronic
1065082898 10:22144775-22144797 ACCCAGGAGGAACTCCCTTCAGG + Intergenic
1065810338 10:29437386-29437408 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1065930857 10:30477364-30477386 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1068240887 10:54299645-54299667 ATCTAGGAGGAACTCCCTTCAGG + Intronic
1068791988 10:61039033-61039055 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1069364742 10:67685473-67685495 ACCTAGGAGGAACTCCCTTCAGG - Intronic
1070644321 10:78190978-78191000 ACCTAGGAAGCACTTCATGCAGG - Intergenic
1071283285 10:84122621-84122643 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
1071327171 10:84529004-84529026 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1071835211 10:89411230-89411252 ATCTAGGAGGAACTCCCTTCAGG + Intronic
1072334616 10:94386473-94386495 GCCTAGGAGGAACTCCCTTCAGG + Intergenic
1072378330 10:94839806-94839828 ACATAGGAGGAACTCCCTTCAGG - Intronic
1072391943 10:94996403-94996425 ACCTAAGAGGAACTCCCTTCAGG - Intergenic
1072472133 10:95722738-95722760 ACCTAGGAGGAACTCCCTTCAGG - Intronic
1074613276 10:115041150-115041172 ACATAGGAGGAACTGCCTTCAGG + Intergenic
1074742426 10:116498218-116498240 ACCTAGGAAGAACTCCCTTCAGG - Intergenic
1075146805 10:119889324-119889346 ATCTAGGAGGAACTCCCTTCAGG + Intronic
1078349359 11:10580138-10580160 GGCTGGGAGGGACTCCATTCAGG + Intronic
1079255031 11:18820386-18820408 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1079811185 11:25001404-25001426 ATCTAGGAGGAACTCCCTTCAGG - Intronic
1079933978 11:26595654-26595676 ACCTAGGAGGAACTCCCTTCAGG - Intronic
1081033664 11:38115535-38115557 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1081070407 11:38603572-38603594 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1081146359 11:39565637-39565659 ACCCAGGAGGAACTCCCTTCAGG + Intergenic
1083089742 11:60187371-60187393 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1084632184 11:70360196-70360218 ACCCAGAAGCATCTCCATTCTGG + Intronic
1086317886 11:85612333-85612355 ACCTAGGAGGAACTCCCTTCAGG + Intronic
1086320098 11:85636965-85636987 ACCTAGAAGGAACTCAATTGAGG + Intergenic
1086973582 11:93108935-93108957 ACCTAGGAGGAATTCCCTTCAGG - Intergenic
1086987287 11:93264083-93264105 ACCTAGGAGAAACTCGCTTCAGG + Intergenic
1087458775 11:98420947-98420969 ACCTAGGAGCAACTCCCTTCAGG - Intergenic
1087640202 11:100748385-100748407 ACCTACGAGGAACTCCCTTCAGG - Intronic
1087894664 11:103573972-103573994 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1088129278 11:106467590-106467612 GCTGAGGAGGAAGTCCATTCAGG - Intergenic
1090323890 11:125868332-125868354 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
1091034889 11:132224220-132224242 ACCGAGGAGGCACTCCCCTCAGG + Intronic
1091223524 11:133944775-133944797 ACCCGGGAGCACCTCCATTCAGG + Intronic
1091814650 12:3428116-3428138 ACCTATGAGGAACTCCCTTCAGG - Intronic
1092469683 12:8766703-8766725 ACCTAGGAGGAACTCCCTTCAGG - Intronic
1092811494 12:12275134-12275156 ACAGAGGAGGGAGTCCATTCAGG + Intergenic
1093010250 12:14099879-14099901 ACCTTGGTGGGACTCCATTGTGG - Intergenic
1093348401 12:18068502-18068524 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1093356575 12:18174489-18174511 ACATAGGAGGAGCTCCCTTCAGG + Intronic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1094319523 12:29170276-29170298 ACCAAGGAGGAACTCCCTTCAGG - Intronic
1095138815 12:38638328-38638350 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1095283742 12:40385934-40385956 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1095637211 12:44448715-44448737 ACCAAGGAAGAACTGCCTTCAGG - Intergenic
1096352305 12:50910514-50910536 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1097377500 12:58857586-58857608 ACCTAGGAGGAATTCCCTTCAGG - Intergenic
1098248253 12:68542221-68542243 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1099576622 12:84391470-84391492 ACATAGGAGGAACTCCCTTCAGG - Intergenic
1100050654 12:90445047-90445069 ATCTAGGAGGAACTCCCTTCAGG - Intergenic
1104851714 12:131878807-131878829 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1105225527 13:18428002-18428024 ACCTAGAAGAAACTCCCTTCAGG + Intergenic
1106123061 13:26877909-26877931 GCCGAGGAGGGAGTCCATTCAGG + Intergenic
1106163193 13:27218610-27218632 ACCTAGTAGGAACTCCCTTCAGG + Intergenic
1107834913 13:44405265-44405287 AGCGAGGAAGAACTACATTCTGG - Intergenic
1108515832 13:51201682-51201704 ATCTAGGAGGAACTCCCTTCAGG - Intergenic
1108849085 13:54706039-54706061 ACCTGGGAGGAACTCCCGCCAGG + Intergenic
1108876449 13:55055771-55055793 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1109057415 13:57569010-57569032 AACTAAGAGGAATTCCATTTGGG + Intergenic
1109606885 13:64707750-64707772 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1109909667 13:68892815-68892837 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1111021689 13:82459297-82459319 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1113000058 13:105624828-105624850 ACCTGGGTGGCACTCCAGTCTGG - Intergenic
1113525282 13:110969838-110969860 ACATAGGAGAAACCCCCTTCTGG + Intergenic
1114009978 14:18356353-18356375 ACCTAGGATAAACTCCCTTCAGG + Intergenic
1114236264 14:20826776-20826798 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1114384092 14:22238403-22238425 ACCTAGGAAGAACTCCCTTCAGG + Intergenic
1115211093 14:30967875-30967897 ACCTAGGAGGAAGCCCCTTCAGG + Intronic
1115285105 14:31707111-31707133 ATCTAGGAGGAACTCCCTACAGG - Intronic
1116725704 14:48559179-48559201 ACCTAGGAGAAACTCCCTTCAGG + Intergenic
1117073393 14:52076323-52076345 ACCTTTGAGGAACTACAGTCTGG - Intergenic
1119229681 14:72970312-72970334 ACCTAGGGAGAATTCCCTTCAGG + Exonic
1125690099 15:41589087-41589109 ACCTAGGAGAAACCCCCTTCCGG + Intergenic
1127283917 15:57516275-57516297 ACTTAGGAGGAACTGCATTCGGG - Intronic
1127680649 15:61294061-61294083 ACCTATGAGGAACAACATCCAGG + Intergenic
1128362857 15:66974801-66974823 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1128555797 15:68630970-68630992 ACCTAGGAGGAAGTCCACTAGGG - Intronic
1129788322 15:78323667-78323689 ACCTAGCAGGCACTCCATAAAGG - Intergenic
1130652937 15:85772565-85772587 ACCTAGAACTAACTCCACTCTGG + Intronic
1131624126 15:94100032-94100054 ACCTACAAGGAACTGAATTCTGG + Intergenic
1133318560 16:4899012-4899034 CCCCGGGAGGAACTCCATTGAGG - Exonic
1135125493 16:19806119-19806141 GCCTAGAATGAACTTCATTCAGG - Intronic
1135339166 16:21631620-21631642 ACATAGGAGGAACTCCCTTCAGG - Intronic
1137041730 16:35619360-35619382 ACCTAGGAGGAATTTCCTTCAGG - Intergenic
1138577984 16:57920711-57920733 ACCTAGAAGGAAATTCAGTCCGG + Intronic
1138861811 16:60767150-60767172 ACCAAATAGGACCTCCATTCTGG + Intergenic
1142692665 17:1616416-1616438 ACGGGGTAGGAACTCCATTCTGG + Intronic
1144806647 17:17972296-17972318 CCCCAGGAGGAACTCCATCTTGG + Exonic
1146764008 17:35502539-35502561 ACCTAGGAGGAACTCCCTTCAGG + Intronic
1148333873 17:46828656-46828678 ACCTGGGCAGAACTACATTCTGG - Intronic
1148829106 17:50418511-50418533 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1149274312 17:55016669-55016691 ACCTAGGAGGAACTCCCTTCAGG - Intronic
1149688155 17:58550623-58550645 ACCTATGAGGAAGGACATTCTGG + Intergenic
1151388527 17:73770347-73770369 ACCTAGGGGGAGCTCCATCCGGG + Intergenic
1152453556 17:80399235-80399257 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1153330897 18:3873357-3873379 ACCCAATAGGAAATCCATTCAGG + Intronic
1153401017 18:4683798-4683820 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1153438284 18:5089501-5089523 ACCAAGGAGGAACTCCCTTCAGG + Intergenic
1153826561 18:8880674-8880696 ACCTAGGAGGAACTCCCTTTAGG - Intergenic
1153830247 18:8915583-8915605 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1154527847 18:15311520-15311542 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
1155746353 18:29360476-29360498 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1157836242 18:50905946-50905968 GCCAAGGAGGAAGTCCATTCAGG + Intronic
1161597735 19:5159935-5159957 ACCTAGAAGGTACTCCCTTCAGG - Intronic
1161830410 19:6598787-6598809 ACGTAGGAGGAACTCCCTTCAGG + Intronic
1162108382 19:8385274-8385296 ATCTAGGAGGAACTCCCTTCAGG + Intronic
1162268033 19:9592115-9592137 ACCTAGGAGAAACCCCCTTCTGG - Intergenic
1163867235 19:19784298-19784320 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1163882002 19:19932194-19932216 ACCCAGGAGGCACTCCAGCCTGG + Intronic
1163900907 19:20099462-20099484 ACCTAGGAGGAACTCCCTTCAGG - Intronic
1163929160 19:20372127-20372149 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1163991660 19:21004254-21004276 ACCTAGGAGGAACTCCCTTTAGG + Intergenic
1164057123 19:21631236-21631258 ACCTAAGAGGAAATCCCTTCAGG + Intergenic
1164121708 19:22271683-22271705 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1164130863 19:22360549-22360571 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1164323297 19:24169743-24169765 ACCTAGGAGGAACTCCCTCCAGG - Intergenic
1164992557 19:32694965-32694987 ACATAGGAGGAACCCCCTTCAGG - Intronic
1166800529 19:45454241-45454263 TCCTAGGAGGAAGTCCTTTCTGG - Intronic
924974274 2:158645-158667 ACATAGGAGGAACTCCCTTCAGG - Intergenic
925949398 2:8896847-8896869 GCATAGGAGGAACTCCCTTCAGG - Intronic
926491600 2:13531818-13531840 ACCTAGGAGGAACTCCCTCCAGG - Intergenic
926503198 2:13679826-13679848 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
926864233 2:17340965-17340987 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
928347957 2:30518273-30518295 ACCTAGGAGGAACTTCCTTGAGG + Intronic
928676893 2:33659318-33659340 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
932917434 2:75873767-75873789 AACTAGGAGGAACTCCCTTCAGG + Intergenic
933175486 2:79168453-79168475 ACCGAGGAGGAACTCCCTTCAGG - Intergenic
933342378 2:81039282-81039304 ACCTAGGAAGACCTCCCTTCAGG + Intergenic
933389687 2:81654018-81654040 ACTTAGGAGAAACTCCCTTCTGG - Intergenic
934672161 2:96221324-96221346 ATCTAGGAGGAACTCCCTTCAGG - Intergenic
934867591 2:97826974-97826996 ACCTAGGAGGAACTCCCTTCAGG + Intronic
935011645 2:99141522-99141544 ACCTAGGAGGGACCCCTTCCTGG + Exonic
935048188 2:99500413-99500435 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
935247890 2:101235090-101235112 ATCTAGGAGGAACTCCTTTCAGG + Intronic
935321853 2:101897040-101897062 ACCTAGGAGGAACCCATTTCTGG - Intergenic
935748606 2:106211090-106211112 ACCTAGGAGGAACTCCCTCCAGG + Intergenic
936387469 2:112043016-112043038 ACCTAGAAGGAACTCCCTTCAGG - Intergenic
936469072 2:112781913-112781935 AGTGAGGAGGATCTCCATTCTGG + Intronic
936716584 2:115193867-115193889 ACCTAGGAGAAACTCCCTTCAGG - Intronic
937057417 2:118951247-118951269 ACCTAGGAGGAACTCCCTTCAGG - Intronic
937411514 2:121680946-121680968 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
938526945 2:132142976-132142998 ACTTAGGAGAAACTCCCTTCAGG - Intergenic
938805720 2:134805600-134805622 ATCTAGGAGGAGCTCCCTTCAGG - Intergenic
938984384 2:136559859-136559881 ACTTAGGGGGAATTCCAATCAGG + Intergenic
939493829 2:142905452-142905474 ACCTAGGAGGAACTCCCTTCGGG - Intronic
939824701 2:147000234-147000256 ACCTAAGAAGAACTCCCTTCAGG + Intergenic
939926646 2:148183054-148183076 AGCTATGAGGAAGTCAATTCAGG - Intronic
940352585 2:152705805-152705827 ACCTAGGAGAAACTCCCTTCAGG + Intronic
941243752 2:163071757-163071779 ATCTAGGAGGAACTTCCTTCAGG + Intergenic
941537336 2:166740143-166740165 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
942101914 2:172592029-172592051 ACACAGGAGGAACTCCCTTCAGG - Intronic
942816324 2:180058191-180058213 CCCTAGGAGGAACTCCCTTCAGG + Intergenic
942830633 2:180234776-180234798 ACCTAGGAAGAACTCCCTTCAGG + Intergenic
943102837 2:183508870-183508892 ATCTAGGAGGAACTCCCTTCAGG - Intergenic
943134224 2:183891231-183891253 ATCTAGGAGGAACTCCCTTCAGG + Intergenic
943407952 2:187512461-187512483 ACCTAAGAGGAACTCCCTTCAGG + Intronic
944039497 2:195337848-195337870 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
945720118 2:213408617-213408639 ACCCAGGAGGAATTCCCTTCAGG + Intronic
1168823964 20:796405-796427 ACCTGGGAGAAACCCCCTTCTGG + Intergenic
1170855244 20:20047105-20047127 ACCTTGGATGAACTCCAGTAAGG + Intronic
1171261834 20:23740917-23740939 ATCTAGGAGGAACTCTCTTCAGG + Intergenic
1171270969 20:23816797-23816819 ATCTAGGAAGAACTCTCTTCAGG + Intergenic
1172340890 20:34156557-34156579 ACCAAGGAGGAATTCCCTTCAGG + Intergenic
1175126266 20:56754132-56754154 ACATAGTAGGCACTCCACTCAGG + Intergenic
1175513988 20:59557008-59557030 ACCTAGGAGGAACTCCCTTCCGG - Intergenic
1176769580 21:13057025-13057047 ACCTAGGAGAAACTCCCTTCAGG + Intergenic
1177263742 21:18758476-18758498 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1177895991 21:26856576-26856598 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1178109536 21:29356566-29356588 ATCTAGGAGGAACTCCCTTCAGG - Intronic
1178167088 21:29991707-29991729 ACTTAGAAGGAAATCCATTCAGG + Intergenic
1178836935 21:36106290-36106312 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1179259355 21:39744567-39744589 ACCTAGGAGGATCTTCCTTCAGG - Intergenic
1180434476 22:15287162-15287184 ACCTAGGATAAACTCCCTTCAGG + Intergenic
1180516681 22:16150969-16150991 ACCTAGGAGAAACTCCCTTCAGG + Intergenic
1182311807 22:29414639-29414661 ACCTAGGAGGAACTACCTTCAGG - Intronic
1182688461 22:32138665-32138687 ACCTAGGAGGAACTACCTTCAGG + Intergenic
1182945105 22:34314634-34314656 ACTTAGGAGGAAGTTGATTCTGG + Intergenic
949610162 3:5696084-5696106 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
949611358 3:5706969-5706991 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
950594768 3:13970009-13970031 TCCTAGGAGAAACTCCCTTCAGG - Intronic
950846371 3:16019691-16019713 ACCTAGGAGAAACCCCCTTCTGG - Intergenic
951020976 3:17780534-17780556 ACCTAGGAGGAACTCCCTTCAGG + Intronic
951200942 3:19874889-19874911 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
951239815 3:20274601-20274623 ATCTAGGAGGGACTCCCTTCAGG + Intergenic
952554834 3:34520243-34520265 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
952922453 3:38295144-38295166 ACCTAGGAGGAATTCCCTTCAGG - Intronic
952940479 3:38440518-38440540 ACCTAGGAGGAACCCCCTTTGGG - Intergenic
953622475 3:44545010-44545032 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
953727853 3:45416209-45416231 ACCCAGGAGACACTCCAATCTGG + Intronic
954096679 3:48334152-48334174 ACCTAGGAGGAACTTCCTTTAGG - Intergenic
954599269 3:51855112-51855134 ATCTAGGAGGAACTCCCTTCAGG + Intergenic
954599527 3:51857517-51857539 CCCCAGGAGGAACTCCATCTTGG - Intergenic
954604562 3:51898780-51898802 ACCTACGAGGAGCTCCCTTCAGG + Intronic
956842607 3:73154533-73154555 ATCTAGGAGGAACTCCCTTCAGG - Intergenic
958000051 3:87739217-87739239 ACCTAGAAGGAACTCCCTTCAGG - Intergenic
958016491 3:87944518-87944540 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
958601572 3:96301565-96301587 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
958630033 3:96672558-96672580 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
960063947 3:113350946-113350968 ACCTAGGAGGAACTCCCTTCAGG + Intronic
960720517 3:120621039-120621061 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
961313803 3:126020570-126020592 GCTGAGGAGGAAGTCCATTCAGG - Intronic
962097225 3:132304574-132304596 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
963021596 3:140877242-140877264 ACATAGGAGGAACTCCCTTCAGG + Intergenic
963697212 3:148576617-148576639 ATCTAGGAGGAACTCACTTCAGG + Intergenic
963735410 3:149013062-149013084 ACCTAGGAGTAAGACCAGTCTGG - Intronic
963915549 3:150856047-150856069 ACCTAGGAAGAGCTCCCTTCAGG + Intergenic
963991826 3:151665073-151665095 ACCAAGGAGGAACTCCCTTCAGG - Intergenic
964933201 3:162050647-162050669 ACTTAGGAGGAACTCCCTTCAGG - Intergenic
964953194 3:162323059-162323081 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
964972467 3:162578634-162578656 ATCTAGGAGACACTCCCTTCAGG + Intergenic
965054958 3:163699825-163699847 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
965139677 3:164817327-164817349 ACATAGAAGGAACTCCCTTCAGG + Intergenic
965825003 3:172721323-172721345 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
967584138 3:191191642-191191664 ACATAGGAGGAACTCCCTTCAGG + Intergenic
967623353 3:191660500-191660522 AGCTAGGAGGAACTCCCTTCAGG + Intergenic
968391341 4:195409-195431 ACTAAGGAGGAACTCCCTTCAGG - Intergenic
970092830 4:12429357-12429379 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
970693927 4:18653641-18653663 AGCTTGGAGGGAATCCATTCAGG - Intergenic
972781531 4:42290826-42290848 ACCCAGCAGGAACTCCCTTTAGG - Intergenic
972784812 4:42316553-42316575 ATCTAGGAGGAACTCCCTTCAGG + Intergenic
972991476 4:44826703-44826725 ACCTAGAAGGAACTCCCTTCAGG - Intergenic
973887804 4:55340384-55340406 ACCTAGAAGGAACTCCCTTCAGG + Intergenic
974520237 4:62973342-62973364 ACCTAGGAGGAACCCCCTTCAGG + Intergenic
975314080 4:72932025-72932047 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
976189600 4:82475700-82475722 ACCTAGGAGGAACCCCCTTTAGG + Intergenic
977043716 4:92044221-92044243 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
977834475 4:101632484-101632506 ATCTAGGAGGAACTCCCTTCAGG - Intronic
977972228 4:103225624-103225646 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
978314008 4:107415866-107415888 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
978909298 4:114046327-114046349 ACCTAGGAGGAATTCCCTTCAGG + Intergenic
980438966 4:132816649-132816671 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
980444071 4:132884277-132884299 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
981076750 4:140600263-140600285 ATCTAGGAGAAATTCCTTTCAGG - Intergenic
982701600 4:158663851-158663873 ACATAGGAGGAACTCCCTTCAGG + Intergenic
982877506 4:160666362-160666384 ACATAGGAGGAGCTCCCTTCAGG + Intergenic
983667168 4:170195098-170195120 ACCTAAGAGGAACTCCCTTCAGG - Intergenic
983702449 4:170614658-170614680 ACCTAAGAGAATCTCCATTAGGG - Intergenic
983708244 4:170684763-170684785 ACCTAGGAGGAACCCCCTTCAGG + Intergenic
983834466 4:172371240-172371262 ACATAGGAGGAACTCCTTTCAGG - Intronic
985565222 5:612150-612172 ACCTGGGAGAACCGCCATTCAGG + Intergenic
986136124 5:4980111-4980133 ACCTAGGAGAAATACCATTCTGG - Intergenic
987931045 5:24399538-24399560 ATCTAGGAGGAACTTCCTTCAGG + Intergenic
988245434 5:28674795-28674817 ACCTAGGAGGAAAAAAATTCAGG - Intergenic
988358236 5:30203528-30203550 ACCTAGGAGAAACTCCCTTCAGG + Intergenic
988457256 5:31397269-31397291 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
988740249 5:34062687-34062709 ATCTGGGAGGAACTCCCTTCAGG - Intronic
989096192 5:37783896-37783918 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
989613759 5:43319352-43319374 ACCTAGAAGAAACCCCCTTCTGG - Intergenic
989964155 5:50449469-50449491 ACCTAGGAAGTACTCCCTTCAGG - Intergenic
990117061 5:52402317-52402339 ACCTAGGAGGAATTCCCTTCAGG + Intergenic
990367539 5:55086240-55086262 ATCTAGGAGGAACTCCCTTCAGG - Intergenic
990419374 5:55616460-55616482 ACTTAGGAAGAACTCCCTTCAGG + Intergenic
990763960 5:59161663-59161685 GCCAAGGAGGAAGTCCATTCAGG + Intronic
991305922 5:65175813-65175835 ACCTAGGAGGAACTCCCTTCAGG + Intronic
992293751 5:75306353-75306375 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
992455656 5:76913280-76913302 ACCAAGGAGGAACTCCCTTCAGG + Intronic
993055349 5:82974134-82974156 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
995465425 5:112445760-112445782 ACCTAGGAGGAACTGCCTTCAGG + Intergenic
996100319 5:119438705-119438727 ACATAGAAGGAACTCCCTTCAGG + Intergenic
998552711 5:143092971-143092993 ACCTAGGAGGAACTCCCTTCAGG - Intronic
998915400 5:147006098-147006120 ATCTAGGAGGAACTCCCTTCAGG + Intronic
1000087403 5:157900074-157900096 ACCTGGGAGAAACTCCAGCCTGG - Intergenic
1000236688 5:159368061-159368083 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1001558602 5:172654409-172654431 ACCTAGGAGGAGCTCCCTTCAGG - Intronic
1002999266 6:2316190-2316212 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1003805999 6:9726462-9726484 ATCTAGGAGGAACTCCCTTCAGG + Intronic
1004236610 6:13880218-13880240 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1005104636 6:22210631-22210653 ACCTAGGAGAAACTACATCTAGG + Intergenic
1005323889 6:24681007-24681029 ACCTAGGAGGAACTCCCTTCAGG - Intronic
1005461786 6:26075927-26075949 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1006222050 6:32499456-32499478 ATCTAGGGGGAACTCCCCTCAGG + Intergenic
1008123329 6:47642374-47642396 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1008582524 6:52919837-52919859 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1009544557 6:65006678-65006700 AGCTAGGAGGAACTCCCTTCAGG + Intronic
1009635618 6:66260761-66260783 ACCTAGGAGGAACTCACTTCAGG + Intergenic
1010075282 6:71790666-71790688 ATCTAGGAGGAACTCCCTTCAGG + Intergenic
1010893273 6:81339071-81339093 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1011076624 6:83445540-83445562 ACCTAGGAAGAACTCCCTTCAGG + Intergenic
1011190029 6:84718773-84718795 ACCTAGGAGGAACCCCCTTCAGG - Intronic
1011450016 6:87482649-87482671 ACCTAGAAGGAACTCCCTTCAGG - Intronic
1011540127 6:88419653-88419675 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1011570205 6:88726562-88726584 ACCTAGGAGGAACTCCCTTCAGG + Intronic
1012441078 6:99262965-99262987 ATCTAGGAGGAAATCCCTTCAGG - Intergenic
1013022019 6:106230047-106230069 ACCTAGGAGGAACTCCCTTCAGG + Intronic
1013532506 6:111033068-111033090 AGCTAGGAGGAAAAACATTCAGG - Intergenic
1013543322 6:111132756-111132778 ATCTAGGAGGAACTCCCTTCAGG + Intronic
1015171808 6:130262529-130262551 ACCTAAGAGGAACTCCCTTCAGG + Intronic
1016343409 6:143085836-143085858 ACCTAGGAGGAACTCCCTTCAGG - Intronic
1018181848 6:161229916-161229938 ACCTAGAAGCACCTCCATCCAGG - Intronic
1018191546 6:161313738-161313760 ACCTAGGAGGAACTACCTTCAGG - Intergenic
1018687362 6:166314245-166314267 ACCCAGGAGGAAATCCCTTCAGG + Intergenic
1018760814 6:166892969-166892991 ATCTAGGAGGAACTCCCTTCAGG + Intronic
1020044029 7:5026980-5027002 ACCTAGGAGGAACTCCCTTCAGG - Intronic
1020507950 7:9017807-9017829 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1020745202 7:12071254-12071276 ACCTAGGAGACACTCCCTTCAGG + Intergenic
1021356138 7:19655147-19655169 ACCTAGGAGGAACTCTCTTCAGG - Intergenic
1021756271 7:23856144-23856166 ACCTAGGAGGAACTGTCTTCAGG - Intergenic
1023077753 7:36500648-36500670 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1023436509 7:40145925-40145947 ACCTTGGAGGAACTCCCTTCAGG - Intronic
1023439502 7:40171435-40171457 ACCTAGGAGGAACTCCATTCAGG - Intronic
1023798476 7:43813170-43813192 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1023798933 7:43816207-43816229 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1025798253 7:64759862-64759884 ATATAGGAGGAACTCCCTTCAGG - Intergenic
1028588834 7:92476073-92476095 ACCTAGGCGGAACTCCCTTCAGG - Intronic
1030420712 7:109303337-109303359 ATGTAGGAAGAACTCCCTTCAGG + Intergenic
1031471264 7:122172082-122172104 ACCTAGGAAGAACTCCCTTCGGG + Intergenic
1031732242 7:125313853-125313875 ATCTAGGAGGAACTTCCTTCAGG + Intergenic
1032426280 7:131824668-131824690 ACCTAGAAGGAACTCCCTTCAGG - Intergenic
1032725603 7:134587697-134587719 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1034249036 7:149673568-149673590 AACTAGGAGGAACTCCCTTCAGG + Intergenic
1034579436 7:152029789-152029811 ATCTAGGAGGAACTCCCTTCAGG - Intronic
1035835082 8:2741459-2741481 GCTGAGGAGGAAGTCCATTCAGG - Intergenic
1037910859 8:22742832-22742854 ACCTAGCAGGAGCTCCATAGAGG - Intronic
1038122491 8:24633030-24633052 ACCTGGGAGGCACTCCAGCCTGG + Intergenic
1039876968 8:41595208-41595230 ACCTAGGAGGAACTCCCTTCAGG - Intronic
1041226953 8:55709902-55709924 ACCTAGGAGGAACTCCCTTCAGG + Intronic
1042088084 8:65130628-65130650 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1043613390 8:82093555-82093577 ACCTAGGAGGAACTCCCTTTAGG - Intergenic
1044456208 8:92395206-92395228 ACATAGGAGGAACTCCCTTCAGG - Intergenic
1048677967 8:136806008-136806030 GCCGAGGAGAAAGTCCATTCAGG + Intergenic
1049877493 8:145034752-145034774 ACCTAAGAGGAACTCCCTTCAGG + Intergenic
1052289965 9:26829296-26829318 ATCTAGGAGGAACTCTCTTCAGG + Intergenic
1052507937 9:29379089-29379111 ACCTAGGAGGGACTGCCTTCAGG + Intergenic
1052538669 9:29778869-29778891 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
1053110956 9:35459791-35459813 ACCTAGGAGGAACCCTCTTCAGG - Intergenic
1053705641 9:40750331-40750353 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
1054415718 9:64873938-64873960 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
1054465366 9:65490250-65490272 GCAGAGGAGGAAGTCCATTCAGG + Intergenic
1056414615 9:86364445-86364467 ACCCAGGAGAAACCCCCTTCCGG - Intergenic
1056704776 9:88942659-88942681 ACCTAGGAGGAAATCCCTTCAGG - Intergenic
1057447963 9:95131813-95131835 ACCAAGGAGGAGCTGCATACTGG + Intronic
1060939550 9:127535638-127535660 ACCTAGAGGGAACTGCATCCTGG - Intronic
1186254268 X:7702062-7702084 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1186440411 X:9581022-9581044 CCAGAGGAGGAAGTCCATTCAGG + Intronic
1186604442 X:11075827-11075849 ACCTAGGAGCAACAGCATTCTGG + Intergenic
1188097989 X:26046097-26046119 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1188136966 X:26503336-26503358 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1188779663 X:34265984-34266006 ACTTGGGAGGAACTCCTTACAGG - Intergenic
1189034400 X:37480735-37480757 ACCTATGAGGAACTCCCTTCAGG + Intronic
1189834052 X:45003276-45003298 ACCTAGGAGGAACTCCCTTCAGG - Intronic
1190270070 X:48855672-48855694 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1190771076 X:53514636-53514658 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1191167242 X:57403782-57403804 ACCTAGGAGGGACTCCCTTCAGG - Intronic
1191918119 X:66224372-66224394 ACCTAGGAGGAACTCCCTTCAGG - Intronic
1192283308 X:69706929-69706951 GCCTAGGAAGAAGTCCATTCAGG + Intronic
1192482311 X:71496195-71496217 ATCTAGGAGGAACTCCCTTCAGG - Intronic
1192915617 X:75648434-75648456 ACCTAGGAGGAACTCACTTCAGG - Intergenic
1193172121 X:78348594-78348616 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1193306490 X:79957817-79957839 ACCTAGGAGGAACTCCCCTCAGG + Intergenic
1193717191 X:84946655-84946677 ACCTAGGAGGAACTCACTTCAGG + Intergenic
1193919701 X:87409808-87409830 TCATAGGCGGCACTCCATTCAGG + Intergenic
1194403953 X:93470316-93470338 ACGTAGAGGGAACCCCATTCAGG + Intergenic
1194630835 X:96281183-96281205 ACCTACGAGGAAGTCAAATCAGG + Intergenic
1195847070 X:109240311-109240333 ACCTAGGAGGAACCCCCTTCAGG - Intergenic
1195850718 X:109279110-109279132 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1196126919 X:112110860-112110882 ATCTAGGAGGAACTCCCTTCAGG - Intergenic
1198742307 X:139854012-139854034 ACCTAGGAGGAACTCCCTTCAGG + Intronic
1199278397 X:145972121-145972143 ACCTAGGAGGAACTCCCTTTAGG + Intergenic
1199637610 X:149828200-149828222 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1200694678 Y:6348452-6348474 ACCTAGGAGGAATTTCCTTCAGG - Intergenic
1200711576 Y:6489435-6489457 ACCTATGAGGAGCTCCCTTCAGG + Intergenic
1200763437 Y:7060911-7060933 ACCTAGGTGGAACTCCTTTCAGG - Intronic
1200851749 Y:7890503-7890525 ATCTAGGAGGAACTCCCTTCAGG - Intergenic
1200880408 Y:8206627-8206649 ATCTAGGATGAACTCCCTTCAGG - Intergenic
1200945511 Y:8831465-8831487 ACCTGGGATGATCTCCCTTCAGG + Intergenic
1201022358 Y:9672544-9672566 ACCTATGAGGATCTCCCTTCAGG - Intergenic
1201040599 Y:9826258-9826280 ACCTAGGAGGAATTTCCTTCAGG + Intergenic
1201308150 Y:12568970-12568992 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1201568193 Y:15387987-15388009 ACATAGGAGGAACTCCCTTCAGG - Intergenic
1201648571 Y:16261942-16261964 GCCTAGGAGGAACCCCCTTCAGG - Intergenic
1201654239 Y:16323359-16323381 GCCTAGGAGGAACCCCCTTCAGG + Intergenic
1201891607 Y:18948797-18948819 GCCCAGGAGAAAGTCCATTCAGG - Intergenic
1201900061 Y:19039974-19039996 ACCTAGGAGGAACTCCCTTCTGG - Intergenic
1201905450 Y:19081971-19081993 ACCTACGAGGAACTCCCTTCAGG + Intergenic
1201919702 Y:19221125-19221147 ACCTAGGAGGTGCTCCTTTCAGG + Intergenic
1202074425 Y:21024140-21024162 ACATAGGAGGAACTCCCTTCAGG - Intergenic
1202089689 Y:21176890-21176912 ACCTAGGAAGAACTCCCTTTAGG - Intergenic
1202192207 Y:22257138-22257160 ACCTAGGAGGAACTCCCTTCAGG - Intergenic