ID: 1023447857

View in Genome Browser
Species Human (GRCh38)
Location 7:40250798-40250820
Sequence AAATGACTTCAACATCTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 407}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023447857_1023447859 18 Left 1023447857 7:40250798-40250820 CCCTTAAGATGTTGAAGTCATTT 0: 1
1: 0
2: 3
3: 56
4: 407
Right 1023447859 7:40250839-40250861 TTTTTTTTTTTTTTTTAAGACGG 0: 1944
1: 89534
2: 65843
3: 89503
4: 176988
1023447857_1023447860 19 Left 1023447857 7:40250798-40250820 CCCTTAAGATGTTGAAGTCATTT 0: 1
1: 0
2: 3
3: 56
4: 407
Right 1023447860 7:40250840-40250862 TTTTTTTTTTTTTTTAAGACGGG 0: 622
1: 15379
2: 19928
3: 38337
4: 83422
1023447857_1023447861 20 Left 1023447857 7:40250798-40250820 CCCTTAAGATGTTGAAGTCATTT 0: 1
1: 0
2: 3
3: 56
4: 407
Right 1023447861 7:40250841-40250863 TTTTTTTTTTTTTTAAGACGGGG 0: 46
1: 2004
2: 20553
3: 31449
4: 158452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023447857 Original CRISPR AAATGACTTCAACATCTTAA GGG (reversed) Intronic
902539019 1:17139210-17139232 AAATAACTCCACCATTTTAATGG + Intergenic
904143800 1:28373832-28373854 AAGTCACTTCAACATTTTAGAGG - Intronic
904868786 1:33603312-33603334 AAAAGACTTTGACATCTTCATGG + Intronic
906590513 1:47020779-47020801 AATAGACTTCCACATCTTAATGG + Intergenic
909078818 1:71085100-71085122 AAATGACTTAAACAACAAAAAGG + Intergenic
909356693 1:74717662-74717684 AAGTTACTTAAACATCTCAAGGG - Intronic
909834718 1:80239799-80239821 AAATAGCCTCCACATCTTAATGG - Intergenic
910908376 1:92207326-92207348 AAATTACTTCAACATAATGAAGG - Intergenic
910941235 1:92536558-92536580 AAAGGACTTCATCATCATTAAGG + Intronic
911314822 1:96343233-96343255 AAATGACTTTAAAATATAAAGGG + Intergenic
911932734 1:103925450-103925472 AAATCACTTCAACATAATAAAGG - Intergenic
912260214 1:108103682-108103704 AAATGACTTCAAAATCTCCATGG - Intergenic
912275648 1:108255510-108255532 AAATTTCTTCAACATCATAAAGG - Intergenic
912292576 1:108438839-108438861 AAATTTCTTCAACATCATAAAGG + Intronic
915612482 1:157005425-157005447 AGTGGACTTCAACATCCTAAAGG + Intronic
917185108 1:172344792-172344814 GAATCACTTCAAAATATTAATGG + Intronic
918670899 1:187215563-187215585 AAAGGACTTCAAAATCCTCATGG + Intergenic
918985225 1:191616474-191616496 AAATGAGTTCAACCTGTTTAGGG + Intergenic
919040677 1:192383935-192383957 AAATTACCTCAACATAGTAAAGG + Intergenic
919069696 1:192738332-192738354 AAATTACTTCATTATCTTGAGGG + Intergenic
920983187 1:210857688-210857710 AATTGAAAGCAACATCTTAATGG - Intronic
921552897 1:216560463-216560485 AAATGGCTTAAACATATTTATGG - Intronic
922548979 1:226480078-226480100 CAATGCCTTCAACATTCTAAAGG - Intergenic
923071738 1:230571751-230571773 AAATTAGTTCAACATTTTTAAGG - Intergenic
923290359 1:232539435-232539457 AAATGACCTGAACATCTTCAAGG + Intronic
924920965 1:248628624-248628646 ATATGACTTCAGCATGGTAAAGG - Intergenic
1063124588 10:3127399-3127421 GAATGACATCAACCGCTTAATGG - Intronic
1064478161 10:15713952-15713974 AGATGACTTCCAAATCTCAATGG + Intronic
1065074959 10:22068452-22068474 AAATTACCTCAACATACTAAAGG - Intergenic
1065273277 10:24059030-24059052 AAATTACCTCAACATAATAAAGG - Intronic
1067260327 10:44684215-44684237 GAGTGACTTCAATATCTTAATGG - Intergenic
1067738411 10:48877222-48877244 AACTAACTTAAAAATCTTAAAGG - Intronic
1068504003 10:57876050-57876072 AAATGACCTCAATATCTCAGTGG + Intergenic
1068630400 10:59291651-59291673 AAATGACTTCAACCTGGAAAGGG + Intronic
1068869253 10:61926059-61926081 AAATCATTTCATCATGTTAAGGG + Intronic
1069158673 10:65062339-65062361 AAATAACTTCAACTTGTTAATGG + Intergenic
1069178217 10:65321800-65321822 CAAAGATTTCAAAATCTTAATGG - Intergenic
1069301355 10:66912504-66912526 AAATGTTTTCAATATCTTACAGG - Intronic
1069352333 10:67543964-67543986 AACTGTCTTGAACATTTTAAAGG - Intronic
1071142922 10:82533581-82533603 AAATTACTTCAACATAATGAAGG + Intronic
1071343814 10:84672490-84672512 AAATGCCTTCAAGAACTTTATGG - Intergenic
1071628796 10:87200838-87200860 AAATGACTTCAACAGACGAATGG - Intergenic
1071812021 10:89192826-89192848 AAATCACATGATCATCTTAATGG - Intergenic
1072224294 10:93353688-93353710 AAATAACCTCAACATGTAAAGGG + Intronic
1072513905 10:96157911-96157933 AAATGACTTTGATATCTCAAAGG + Exonic
1072628791 10:97131608-97131630 AAATGGCTCCACCACCTTAAAGG + Intronic
1073807520 10:107114596-107114618 AATTTACTTCAACATGTTAAAGG + Intronic
1074245520 10:111687493-111687515 AAACAACTTCAAAATCTCAATGG + Intergenic
1074246287 10:111697062-111697084 AAATTATTTCACCATCTTTAGGG - Intergenic
1077180873 11:1214921-1214943 AAACTACTTCAACATGATAAGGG + Intergenic
1077725557 11:4671712-4671734 AGATGAATTAAAAATCTTAAAGG - Intergenic
1077807158 11:5601863-5601885 AAAACACTTCCACTTCTTAACGG - Intronic
1078231414 11:9446625-9446647 AATTGAAAGCAACATCTTAATGG + Exonic
1078765163 11:14289551-14289573 AAATGACTGGCATATCTTAAGGG + Intronic
1080526249 11:33123105-33123127 AAATTATTTCAACTTCTAAATGG + Intronic
1080785159 11:35468593-35468615 AAAACACATCAACATCTCAAGGG - Intronic
1081030115 11:38069527-38069549 AATTTACTTCAACATAATAACGG - Intergenic
1081428140 11:42947779-42947801 AAAGAAATTCAGCATCTTAAAGG + Intergenic
1082617787 11:55382478-55382500 AAATGAAATCAATATCTTGAAGG + Intergenic
1082837946 11:57665352-57665374 AAATTACTTTAATATGTTAATGG - Intergenic
1083400526 11:62420179-62420201 ATAGGACTGCAACATGTTAAGGG + Intronic
1085568307 11:77536146-77536168 AAATTACCTCAACATAATAAAGG + Intronic
1086754931 11:90548493-90548515 AAATCACTTCTACATATTTATGG - Intergenic
1086977106 11:93145695-93145717 AAATGACTTCAGCATTTTGTTGG - Exonic
1087270463 11:96106433-96106455 CTATGAATTCATCATCTTAAAGG + Intronic
1091128546 11:133124017-133124039 CAATGACTACCACACCTTAAAGG + Intronic
1091609114 12:1988145-1988167 AAATGACACCAAAATCTCAATGG + Intronic
1092582395 12:9857386-9857408 AAAAGACTTCAAGATTATAATGG + Intronic
1093009663 12:14093283-14093305 AAATTACTTCAACATTATAAAGG + Intergenic
1094550334 12:31445095-31445117 AAATAACTCCAACATTTGAAGGG + Intronic
1094799785 12:34019892-34019914 AAATAAAGTCAAAATCTTAATGG + Intergenic
1095112574 12:38314196-38314218 AAATAAAGTCAAAATCTTAATGG + Intergenic
1095124163 12:38456087-38456109 AAATGGCTACAACATTATAATGG - Intergenic
1095274528 12:40265103-40265125 AAATGACTCAAACATATTATAGG - Intronic
1096467396 12:51854588-51854610 AACTGACTCCAACATATTACTGG - Intergenic
1097480096 12:60113182-60113204 ATATGACTTCAACCCCTTGAGGG + Intergenic
1097547375 12:61021519-61021541 AAATGACTTCAACAAATTTTAGG - Intergenic
1097631661 12:62071597-62071619 AAATTACTTCAACTTCTCCATGG + Intronic
1097742882 12:63265301-63265323 AACACACTTCAACATATTAAAGG - Intergenic
1097769773 12:63570344-63570366 AAATGATTTCTAGATCTTACTGG - Intronic
1097933829 12:65222104-65222126 AAATTATCTCAACATATTAAAGG - Intronic
1098021845 12:66164166-66164188 AAACTACCTCAACATATTAAAGG + Intronic
1098278990 12:68844090-68844112 AAATGGATTCAACATGTTTATGG + Exonic
1098895489 12:76055641-76055663 GAATGAGTTTAACATCTTTATGG + Intronic
1098924203 12:76331155-76331177 AAATGAAATCAACATGTTGAGGG + Intergenic
1098984233 12:76993361-76993383 AAATTACCTCAACATAATAAAGG + Intergenic
1099645887 12:85355761-85355783 AAATGAGTTCAAGTTCATAACGG + Intergenic
1099670727 12:85688737-85688759 TAAAGACTTTAATATCTTAAAGG - Intergenic
1100132267 12:91510866-91510888 AATGGACTACAACATTTTAAAGG - Intergenic
1100675630 12:96863662-96863684 AAATGACTTGCAGATCTGAATGG + Intronic
1102140711 12:110612860-110612882 AAATAATTTAGACATCTTAAAGG - Intergenic
1104051789 12:125199629-125199651 ACATAACTTCAAAATCTTATTGG - Intronic
1106688814 13:32091360-32091382 AAATGACTTCCCCATCATGAGGG - Intronic
1107003021 13:35573340-35573362 CAATGACTGTAACTTCTTAAAGG - Intronic
1107030165 13:35842618-35842640 AATTCACTTCAAGATCTTACTGG + Intronic
1108001292 13:45907708-45907730 AAAAGGCTTCAACATCTTAATGG + Intergenic
1108049415 13:46416286-46416308 AAATGTCTTAAATATCTTATGGG - Intronic
1108199203 13:48025998-48026020 AAATAAATTCCACATCTCAATGG + Intergenic
1108983811 13:56557151-56557173 AAATGACTTCATGATTTTTATGG - Intergenic
1109541934 13:63789565-63789587 AAATGTCTTAAATATCTTATGGG - Intergenic
1109976208 13:69835748-69835770 TAATAATTTCAACATCTAAAAGG - Intronic
1109999067 13:70170294-70170316 AAGTGTCTTCAAAACCTTAATGG + Intergenic
1110241796 13:73276010-73276032 AAATTACCTCAACATAATAAAGG + Intergenic
1110625554 13:77651748-77651770 AAATGATGTGAACATGTTAAAGG + Intergenic
1110686876 13:78385921-78385943 AAATGATTTGAACATTTTACTGG + Intergenic
1111066472 13:83100265-83100287 AAATGAATTTAAGTTCTTAAGGG - Intergenic
1111524188 13:89447039-89447061 AAATGACTGCTACATCGTAAAGG - Intergenic
1111709205 13:91790034-91790056 TAAAGACTTAATCATCTTAAAGG + Intronic
1111710096 13:91800659-91800681 AAATGACTCCCACCTCTAAAAGG - Intronic
1112564268 13:100539355-100539377 AAATTACCTCAACATCATAAAGG - Intronic
1112654424 13:101434741-101434763 ATCTGACTTAAACTTCTTAAGGG - Intergenic
1112735937 13:102417693-102417715 AACTGGCTTCAAAATCTTTAAGG - Intergenic
1113003573 13:105672654-105672676 AACTGATTTCAACATCTTACTGG + Intergenic
1113256055 13:108506839-108506861 AAATTACCTCAACATAATAAAGG - Intergenic
1113292855 13:108925203-108925225 AGATAAGTTAAACATCTTAAAGG - Intronic
1113598441 13:111550692-111550714 AAAGGTCTTCTGCATCTTAAAGG + Intergenic
1115724379 14:36196806-36196828 AATTGATTCTAACATCTTAACGG + Intergenic
1116072664 14:40068677-40068699 AAATGAGATCAAGATCTAAAGGG - Intergenic
1116423953 14:44766842-44766864 AAATGACATCAACACATCAACGG - Intergenic
1116431696 14:44853525-44853547 AATGGACTTGAACATATTAAAGG - Intergenic
1117980575 14:61338958-61338980 ATTTGACTTCAAAATATTAATGG - Intronic
1118104801 14:62646071-62646093 AAATTAATTCAAAATCGTAATGG - Intergenic
1118472700 14:66089826-66089848 AAATGACTTGAATATATTAAGGG + Intergenic
1119072487 14:71601243-71601265 AACAGACCTCAACATCATAAAGG - Intronic
1123178930 14:106448818-106448840 ACATGAGTTCAAAATCTTTATGG + Intergenic
1123959659 15:25383684-25383706 AAATTACTTCAACATAATGAAGG + Intronic
1126564551 15:50081428-50081450 AAATTACTTCAAGATCTTCTTGG - Intronic
1126717977 15:51542288-51542310 ACCTGACTTCAACATATTTATGG + Intronic
1126947690 15:53842004-53842026 AAAAGACATCAACATCTTAATGG - Intergenic
1127577651 15:60307705-60307727 AAATGAAATCTACAGCTTAAGGG + Intergenic
1128923711 15:71634913-71634935 AAATGAATACTCCATCTTAATGG + Intronic
1129831601 15:78674520-78674542 AAATGAGTTTAATATGTTAAAGG + Intronic
1132319139 15:100912631-100912653 AAATGACCTAAAAATCTCAATGG + Intronic
1133553153 16:6878527-6878549 AAATGACTCCAAAATCTAAAAGG - Intronic
1134088708 16:11377464-11377486 AAATGACCTCAACATAATAAAGG - Intronic
1137793345 16:51193994-51194016 AAATAATTCCAACATCTTCAAGG - Intergenic
1137852346 16:51758278-51758300 AAATGAGGTCAATATCTTTATGG + Intergenic
1139081954 16:63532822-63532844 AAATGAATGCAACATGCTAAAGG - Intergenic
1139773706 16:69299636-69299658 AAATGGGTTCACCATCTCAAGGG + Exonic
1140654753 16:77128187-77128209 AAATGACTTCAATATAATAATGG + Intergenic
1141072202 16:80967861-80967883 ATATGACAGCAAAATCTTAAGGG - Exonic
1141209962 16:81969451-81969473 AAATTACCTCAACATAATAAAGG - Intergenic
1142587814 17:985379-985401 AAATGATTTCAACTTGCTAAAGG + Intergenic
1143942781 17:10560046-10560068 AAATGCCTTCACCAAATTAAAGG + Intergenic
1145942613 17:28750614-28750636 AAGTGCCTTGAACATCTTGAAGG - Exonic
1146169766 17:30624011-30624033 AAATTAGTTCAACGTCTTTATGG - Intergenic
1146463864 17:33070168-33070190 AAATGACAGCAATATCGTAAAGG - Intronic
1148031658 17:44625892-44625914 AACTGACTGTAACATCTTACTGG + Intergenic
1149080051 17:52644738-52644760 TAAAGATTTCAACATCCTAATGG - Intergenic
1149808622 17:59643905-59643927 AAATAACTGCTACATGTTAAGGG + Intronic
1151057579 17:71051254-71051276 AAAGATCTTAAACATCTTAAAGG + Intergenic
1151644035 17:75417366-75417388 AACTGACTTCATCTCCTTAACGG - Intergenic
1153098045 18:1431592-1431614 AAATAATTTCAACATCTTTAAGG - Intergenic
1153205994 18:2701901-2701923 AATTAATTTCAACATCTTACAGG - Intronic
1153389802 18:4543613-4543635 AAATCATTCCAACATCTCAATGG + Intergenic
1153399938 18:4672887-4672909 AAATGAATTCCACTTCTTGATGG - Intergenic
1154150213 18:11900581-11900603 AAAGGTTTTCCACATCTTAATGG - Intronic
1154224539 18:12490777-12490799 AAATTACCTCAACATAATAAAGG + Intronic
1154357682 18:13634051-13634073 AAGCTACTTCAACATCATAAAGG + Intronic
1155352006 18:24916500-24916522 CTATGACTTTGACATCTTAAAGG + Intergenic
1155411864 18:25555209-25555231 AAATGACTTCTACATCTTTGTGG - Intergenic
1155418094 18:25623017-25623039 AAATGACTTCAACATAATGAAGG - Intergenic
1155763308 18:29593110-29593132 AAATGACCTCAACATAATAAAGG + Intergenic
1156658546 18:39317553-39317575 AACTGACTTTAATATCTTACTGG - Intergenic
1157055995 18:44229713-44229735 AAAAGAATTCACCATCTTAGGGG - Intergenic
1157330129 18:46697975-46697997 GAAGGTCTTCAACATCCTAAGGG + Intronic
1158062790 18:53366346-53366368 AAATGATATTAACATATTAAGGG - Intronic
1158387407 18:57011461-57011483 ATATCATTTTAACATCTTAATGG - Intronic
1158703258 18:59768413-59768435 AAAAAAATTCAACATCTTAGTGG + Intergenic
1158755896 18:60324939-60324961 AAGTTGCTTCAACTTCTTAAAGG + Intergenic
1158818779 18:61134446-61134468 AAATACCTGCAACATCTTATTGG - Intergenic
1158975286 18:62705615-62705637 AAATGAATTAAACAACTTACGGG + Intergenic
1161744913 19:6050442-6050464 AAATAACTTCAAGAACTTAAAGG + Intronic
1164543734 19:29141981-29142003 AAAAGACCTCAAGATCTCAATGG + Intergenic
1165641422 19:37391057-37391079 AAATGATTTTAACTCCTTAAGGG - Intronic
926872054 2:17431208-17431230 TAAAGAATTCAACATCTTCATGG - Intergenic
927384411 2:22516435-22516457 AAACAACCTCAAGATCTTAATGG + Intergenic
927742256 2:25582067-25582089 AAATGATTTAAACATTTTATGGG - Intronic
930294288 2:49535088-49535110 AAATTACTTCAACATAATAAAGG + Intergenic
930395454 2:50817842-50817864 AAATTACTTCAACATAATAAAGG + Intronic
931002929 2:57809482-57809504 AAATCACTTCAATTTCTTATAGG + Intergenic
931009383 2:57891071-57891093 ACATGAGTTCTAGATCTTAAAGG + Intergenic
931793888 2:65690993-65691015 AAATGGCTGCAACATCAGAATGG + Intergenic
931920073 2:67005658-67005680 AAATGAATTTTAAATCTTAATGG - Intergenic
932284463 2:70520625-70520647 ACGTGACTTGAACATTTTAAGGG - Intronic
932443352 2:71753231-71753253 AAATAACTCCACCATTTTAAAGG - Intergenic
933007880 2:77018759-77018781 AAAGAACTTAAACTTCTTAAAGG - Intronic
934528692 2:95070470-95070492 AAATGATGCCAACTTCTTAAAGG + Intergenic
934548286 2:95237428-95237450 AATTAAGTTCACCATCTTAATGG - Intronic
935533617 2:104265837-104265859 AAATGTCCTCAACATAATAAAGG + Intergenic
935871583 2:107456256-107456278 AACTGTATTCAGCATCTTAAAGG + Intergenic
936527544 2:113251789-113251811 AAAGGATTTCCACATCTTAAGGG - Intronic
936810991 2:116401834-116401856 ACATGAATTCAATATTTTAATGG + Intergenic
937509772 2:122582715-122582737 TAATGTCTTTAACATGTTAAAGG + Intergenic
939058173 2:137387581-137387603 AAATGTCTTCCCCATCCTAATGG + Intronic
939087017 2:137732739-137732761 AAATTACCTCAACATAATAAAGG - Intergenic
939269246 2:139916511-139916533 CAATGACTTAACAATCTTAAAGG + Intergenic
940154667 2:150642674-150642696 AAAGAATATCAACATCTTAAGGG - Intergenic
941413092 2:165185219-165185241 AAATTAAGTCAACATTTTAAAGG + Intronic
941454196 2:165695855-165695877 AAAAGACTACAACATCTTATTGG + Intergenic
941584381 2:167339002-167339024 AAATGTCATCCACATTTTAAGGG - Intergenic
941786969 2:169507597-169507619 AAAGGATTTCTACATTTTAAGGG + Intronic
942162478 2:173206036-173206058 AAATGACTTCTACATCACAATGG - Intronic
942205229 2:173613340-173613362 ACATGAATTCATCATCCTAAAGG + Intergenic
942435726 2:175973086-175973108 AAATGACTTCACCACATTATAGG + Intronic
942447187 2:176085907-176085929 AAATCAATTCCACATCTTTAAGG + Intergenic
942747840 2:179255798-179255820 AAATGGCTTCAAAATTTCAAAGG + Intronic
943352373 2:186810872-186810894 AAATATCTTCATCATTTTAAAGG - Intergenic
943570533 2:189568497-189568519 AAAAGACTTAATCATCTTACTGG + Intronic
944351248 2:198729902-198729924 AAATGACTTCAAGATTTTTGGGG - Intergenic
944457094 2:199906814-199906836 AAATGACATAATCATCTTAATGG - Intergenic
944806744 2:203289885-203289907 GAATGAATTAAACATATTAAAGG - Intronic
945140992 2:206685924-206685946 ATATAACTTCAACATTTTTAGGG - Intronic
946701664 2:222421187-222421209 AAATTACTTTAACTTATTAAAGG + Intergenic
947939839 2:234042687-234042709 AAATTACCTCAACATAATAAAGG + Intergenic
948539311 2:238675761-238675783 AAAGGACTTGAACAACTCAATGG - Intergenic
1169032839 20:2424970-2424992 AATTAAGTTCAACATCTTACAGG + Intronic
1169241983 20:3989900-3989922 AAACAACCTCAAAATCTTAATGG - Intronic
1169360070 20:4940843-4940865 AACTGACTTCAACAGGTTAAAGG + Intronic
1169854347 20:10087103-10087125 GAATGCCTTCAAAATCATAAGGG + Intergenic
1170515296 20:17123295-17123317 AAATGACAGCAACATCACAAGGG - Intergenic
1171500905 20:25592480-25592502 AATTGAAAGCAACATCTTAATGG + Intergenic
1174090824 20:48045663-48045685 CAATCACTTCAATATCTTAATGG - Intergenic
1174932819 20:54833880-54833902 AAATGTCTTCAGCAACTAAATGG - Intergenic
1175425669 20:58864426-58864448 AAGTGAATTCAGCATCTTGAAGG - Intronic
1175668340 20:60879468-60879490 AATTGCCTCCAAGATCTTAAAGG - Intergenic
1176909453 21:14546400-14546422 ATATGACTTCAACATTTACATGG + Intronic
1177117026 21:17098741-17098763 AACTTACTTCAACTCCTTAAAGG + Intergenic
1177209757 21:18056206-18056228 AAATGCCTTCAAAATCTTGAAGG - Intronic
1177600786 21:23310752-23310774 AAAAGACCTCAACAACTTAATGG - Intergenic
1178265049 21:31134830-31134852 AAATGACCTCAACAGCTACAGGG + Intronic
1178786897 21:35662036-35662058 TAGTGACTGCAACATGTTAATGG - Intronic
1179769899 21:43606674-43606696 GAATGACTTGAACATGTTTAGGG - Intronic
1182019515 22:27069270-27069292 AAATGACTTCAACTTTTTTCTGG - Intergenic
1182252553 22:29012710-29012732 AAGTGATTTCAACTTCTGAAGGG + Intronic
1182255733 22:29036959-29036981 ACATGTCTTCAACCTCTTACAGG - Intronic
1182743428 22:32585679-32585701 AAATGACTTCATGATCTAGATGG + Intronic
949459782 3:4278143-4278165 AAAGGACTGCAACATCTTTTTGG + Intronic
950732695 3:14975364-14975386 AAATTACCTCAACATAATAAAGG - Intronic
951605796 3:24433652-24433674 AAATGAATTCACCATCTCATAGG + Intronic
951909438 3:27733977-27733999 AAATGTCTTCAACAGCAGAATGG - Intergenic
952248606 3:31626549-31626571 AAAAGACTTCAATAGATTAAGGG + Intronic
954489904 3:50893797-50893819 AAAGGACATGAACATCTTAAAGG - Intronic
957233071 3:77546043-77546065 AAATGATTTTAACATTTTTAAGG - Intronic
958661299 3:97071318-97071340 TTAGGACTTCAACATCTTTATGG - Intronic
958873594 3:99590012-99590034 AAATGACTTTAACAAGTTGATGG + Intergenic
960102838 3:113762935-113762957 AAAAGGCTTGAACATCTTTAAGG + Intronic
960163705 3:114378323-114378345 AGAAGACTTACACATCTTAATGG + Intronic
960181980 3:114590649-114590671 AAATGCCACCAACATTTTAATGG - Intronic
960369701 3:116819181-116819203 AAATGCCTTCAAGATCTGCAAGG + Intronic
960441889 3:117698392-117698414 AGATGAATCCAACATCTTAAAGG - Intergenic
960444860 3:117735400-117735422 AAATGAAAACAACATTTTAATGG + Intergenic
960576571 3:119235741-119235763 AAATGACTTGTACATGTAAATGG - Intronic
961341317 3:126222638-126222660 AAATCACCTCAACATACTAAAGG + Intergenic
962363159 3:134758385-134758407 AAACGACTACAACACCCTAAGGG - Intronic
962366265 3:134786247-134786269 AAATGGCTTCAAATACTTAAAGG - Intronic
962506420 3:136050869-136050891 AAGTGACCTCAAAATCTTCATGG + Intronic
963491987 3:146013568-146013590 AAATGACACCAAAATCTCAAAGG + Intergenic
963567849 3:146952561-146952583 AAATGATTTCTACATGTTAATGG - Intergenic
964045464 3:152319409-152319431 TAATGACCTCAAGATCTTTATGG - Intronic
964155046 3:153575192-153575214 CAATGACTTCAATTTCTTCATGG - Intergenic
965124146 3:164602739-164602761 AAATTACCTCAACATAATAAAGG - Intergenic
965488186 3:169304536-169304558 AAAGCACTTCAACTTCTGAATGG - Intronic
965775298 3:172223530-172223552 AAATGACTTTAACAGTTTTAGGG + Intronic
967960685 3:194921224-194921246 TAATGACAGCAACATCATAAGGG - Intergenic
968853591 4:3101823-3101845 AAATCACTTCAGCCTCTTGACGG - Intronic
970747017 4:19311272-19311294 AAATGACTTTAACTCCCTAACGG - Intergenic
971096564 4:23412066-23412088 ATATGACTTCAACATCTAATTGG + Intergenic
971788864 4:31141636-31141658 AAATGACTTTTACTTCTAAAAGG - Intronic
972679913 4:41295307-41295329 AAAAGAATTCATCTTCTTAAGGG - Intergenic
973033617 4:45376647-45376669 AAACTACTTCAACATAATAAAGG - Intergenic
973068842 4:45832182-45832204 AAATTACATCATCATCTCAATGG - Intergenic
973277156 4:48322212-48322234 AAATGACTGCAACATCTCAGGGG - Intergenic
974442100 4:61932330-61932352 AAGTTACTTCAACATGATAAAGG - Intronic
974929074 4:68340506-68340528 AAATTTCTTCAAGATCTGAATGG + Intronic
975172805 4:71252008-71252030 AAATGACTGCAAGTTCTTAGGGG - Intronic
976090048 4:81447708-81447730 AAATAATTTCATCATCTTCAAGG + Intronic
976266244 4:83187699-83187721 AAATGACTCAAACATCTAATGGG + Intergenic
976650833 4:87432654-87432676 AAATTACCTCAACATAATAAAGG - Intronic
977033733 4:91922923-91922945 ATATGACCTCAACATTTTATTGG - Intergenic
977187108 4:93953015-93953037 AAATTACCTCAACATAATAAAGG + Intergenic
977821953 4:101482510-101482532 AAAGAACTTCAACAACTCAATGG - Intronic
978353251 4:107842704-107842726 ATCAGACTTCAACATTTTAAAGG + Intronic
978983283 4:114978822-114978844 GAATGACTTCAAGAACTTAGAGG - Intronic
978992041 4:115095962-115095984 AAATGACTTAAAGATTTTAGAGG - Intronic
979155859 4:117389932-117389954 ACATACCTTCAATATCTTAATGG + Intergenic
979485752 4:121268325-121268347 AAATGACTGCAACACCTCAGTGG + Intergenic
980415951 4:132488578-132488600 AAACAACTTCAACATAATAAAGG + Intergenic
980485895 4:133457285-133457307 AAATGGCTTCAAGTGCTTAATGG + Intergenic
980489214 4:133504226-133504248 CATTGAATTCTACATCTTAAAGG + Intergenic
980818909 4:137987260-137987282 AAAGTACTTCAACATAATAAAGG + Intergenic
981798272 4:148624757-148624779 AAATTACCTCAACATAATAAAGG + Intergenic
982063881 4:151633795-151633817 AAACAACTACAACATATTAAAGG + Intronic
982339446 4:154280710-154280732 AAATTATTTCAACATAATAAAGG + Intronic
982353933 4:154445943-154445965 AAATGACTTCAAAATCTCTCAGG + Intronic
982898602 4:160967794-160967816 AAATTACCTCAACATAATAAAGG - Intergenic
983039898 4:162913449-162913471 TAATGACTTAAACATAATAATGG - Intergenic
983499613 4:168483993-168484015 AAGTGACTTTATCATTTTAATGG - Intronic
983656205 4:170087825-170087847 AAATGTCTTTAATTTCTTAAAGG - Intronic
984061718 4:174996762-174996784 AAAAGACTTCAAAATGTTCACGG + Intergenic
984209308 4:176825944-176825966 AAATGGGTTCAATATTTTAATGG + Intergenic
984424033 4:179560639-179560661 AAATGACATCTTCATCTCAATGG + Intergenic
984533078 4:180941863-180941885 TAATAACTTCCACATCTTCATGG - Intergenic
985042930 4:185910377-185910399 AAATGAAGTCAACTTCATAAAGG - Intronic
985587285 5:747157-747179 AAATGACTTCTCACTCTTAAGGG + Intronic
985601835 5:839249-839271 AAATGACTTCTCACTCTTAAGGG + Intronic
986658225 5:10036074-10036096 AAATAACCCCAACATCTCAATGG - Intergenic
988182304 5:27812669-27812691 TAATGTCTTCAGCATCTTCAAGG + Intergenic
988820910 5:34884251-34884273 AAATTACCTCAACATAATAAAGG + Intronic
989598486 5:43180197-43180219 AAATGTATTCAAAATCATAAAGG - Intronic
990812286 5:59741882-59741904 AAATGAATTCATAATCTGAATGG + Intronic
992101710 5:73414332-73414354 AAATGAGGGCAACATCATAAAGG - Intergenic
992114684 5:73528156-73528178 AAATGTCTTCAACATGGTGAAGG + Intergenic
992193336 5:74315671-74315693 AAATGCCTTCAACAAGTGAATGG + Intergenic
992742401 5:79787067-79787089 GACAGACTTCATCATCTTAAGGG + Intronic
993432239 5:87846056-87846078 TAATTATTTCAACAACTTAAAGG - Intergenic
993556111 5:89341060-89341082 AAGTGACTTGAACATCTTACAGG + Intergenic
993708471 5:91197810-91197832 ATATGACTTCAAAATCTCCAGGG + Intergenic
994290291 5:98021862-98021884 AAATGACTGCATGATATTAAAGG - Intergenic
995045818 5:107645270-107645292 AAATTACTTCAACTTCTACAAGG - Intronic
995068892 5:107894896-107894918 AAATGACTCCAAATTATTAAAGG - Intronic
996668191 5:126085008-126085030 AAATTTCTTCAACATAATAAAGG + Intergenic
999886633 5:155931339-155931361 AAATTGCTTCAACATCTTAATGG + Intronic
1000748423 5:165064843-165064865 AAATAAATTCATCAGCTTAACGG - Intergenic
1001623432 5:173108657-173108679 AGGTGACTTCAATATCTTCACGG + Exonic
1001672002 5:173481433-173481455 AAATGTCTTCAACATATTTCTGG - Intergenic
1001926029 5:175637813-175637835 TAAGGACTTCAACATCTTTTGGG - Intergenic
1003965413 6:11248253-11248275 ACATGACTTCTACATGGTAAAGG - Intronic
1004955189 6:20721540-20721562 AAAAGAAATCAACATATTAAAGG - Intronic
1005365447 6:25071255-25071277 AAATGCCTTCAACACCTTTAAGG - Intergenic
1006000329 6:30959659-30959681 AAAAGACTTAAACATATTTAGGG - Intergenic
1006141892 6:31934251-31934273 AAATGACTTTCTCATCTTCAAGG + Exonic
1006547739 6:34793042-34793064 AAAAAACCTCCACATCTTAAAGG - Intronic
1008020311 6:46569519-46569541 AAAGTACTTCAACATAATAAAGG - Intronic
1008302060 6:49853425-49853447 AAAGGACTTCAACATCCACATGG + Intronic
1008404920 6:51108199-51108221 AAATAAATTCAACCTCTTAATGG + Intergenic
1008754188 6:54773978-54774000 AAATCACTTCATTATTTTAAAGG + Intergenic
1009040272 6:58167682-58167704 GAATGTCTACAATATCTTAAAGG - Intergenic
1009061702 6:58403896-58403918 AAATGACTTCAAAAACTTTTGGG + Intergenic
1009249373 6:61278444-61278466 AAATGACTTCAAAAACTTTTGGG + Intergenic
1009338465 6:62524325-62524347 AAATGATTTCAAAATCCTAAAGG - Intergenic
1009974831 6:70661430-70661452 AAATAACTTCAAAATCGTAATGG - Intergenic
1010848361 6:80741018-80741040 AAAATACTTCAACACCGTAAAGG + Intergenic
1010875680 6:81102349-81102371 GAATAACTTCAAAATATTAAAGG - Intergenic
1010931324 6:81807226-81807248 AAATAACTTCCACCTCTTAATGG + Intergenic
1011600883 6:89059134-89059156 CAATGACTTCAAAATTTCAAGGG - Intergenic
1012053734 6:94378240-94378262 CAATGACTTCAATATTTTAAGGG - Intergenic
1012523665 6:100151218-100151240 AAACAACTTCAAGATCTTAATGG + Intergenic
1013715309 6:112953865-112953887 AAATGTCTTTAACATCTTTATGG + Intergenic
1013847127 6:114466848-114466870 AAATGACATGAACATTTTAAAGG - Intergenic
1014510926 6:122321121-122321143 AAATGACCTTAACATTTCAATGG - Intergenic
1015282955 6:131453570-131453592 AAATGACTTGATCAACTTATAGG + Intergenic
1015469014 6:133581648-133581670 AAACAACTTCAACATAATAAAGG + Intergenic
1016751452 6:147634785-147634807 AAATGAGTTCAGCATCTTTTTGG + Intronic
1016897658 6:149069220-149069242 AAATGAAATCAACATATCAAAGG - Intronic
1018317825 6:162574682-162574704 AAATTACTTCAACATTTTGGGGG - Intronic
1018387513 6:163318446-163318468 AACTGACTTGAACACCTGAATGG - Intergenic
1020235288 7:6350376-6350398 AAATAATTTAAACATTTTAAAGG + Intergenic
1020843371 7:13250569-13250591 AATTTACTTCAACATAATAAAGG - Intergenic
1021382756 7:19987978-19988000 AAATTACCTCAACATAATAAAGG - Intergenic
1021504983 7:21372911-21372933 ATATAACTTCTACAACTTAATGG + Intergenic
1021543626 7:21788838-21788860 AATTGATTTTAATATCTTAATGG + Intronic
1021614669 7:22489431-22489453 TTATGACTTCAACATCTTTTTGG - Intronic
1021699776 7:23306583-23306605 AAATTACCTCAACATAATAAGGG - Intronic
1022262110 7:28716107-28716129 AAATTAATTAAACAACTTAATGG - Intronic
1022367128 7:29732436-29732458 AAATGATTTCTAGATCTTACTGG + Intergenic
1022929045 7:35091441-35091463 AAATGATTTCTAGATCTTACTGG - Intergenic
1023447857 7:40250798-40250820 AAATGACTTCAACATCTTAAGGG - Intronic
1023491914 7:40752049-40752071 AAATAACCTCAAGCTCTTAATGG + Intronic
1024029812 7:45449828-45449850 AAATTACCTCAACATAATAAAGG + Intergenic
1024306012 7:47930178-47930200 AAATGGCTTAAGTATCTTAATGG + Intronic
1024537331 7:50448952-50448974 AAATGAGTTTAACATCAAAATGG - Exonic
1024749141 7:52443973-52443995 GAATGACTACAACATTTTAAGGG - Intergenic
1024928563 7:54644789-54644811 AGATGACTTCAACAACTAGAGGG + Intergenic
1025215816 7:57055200-57055222 AAATAATTTCAACTTCCTAAGGG - Intergenic
1025626559 7:63227607-63227629 AAATAATTTCAACTTCCTAAAGG - Intergenic
1025655563 7:63515502-63515524 AAATAATTTCAACTTCCTAAGGG + Intergenic
1026810650 7:73461575-73461597 AAAGGATTTAAACATCTTTATGG - Intronic
1027813236 7:82932662-82932684 GAATGACTTCAACATCTGTGAGG - Intronic
1028716840 7:93980607-93980629 AAATTGCTTCAACATAATAAAGG + Intronic
1029101634 7:98135885-98135907 GAATGATTTCTACATCTTTAAGG - Intronic
1029798143 7:102916923-102916945 AAATGACTTCAATTCTTTAATGG - Intronic
1029825156 7:103185123-103185145 AAATGATTTCTAGATCTTACTGG - Intergenic
1030241088 7:107326147-107326169 AAATTACATCAACATAATAAGGG + Intronic
1030340380 7:108372863-108372885 AATTGAAATCAACATCTCAAAGG + Intronic
1031351513 7:120737664-120737686 AAATGCCTTAAACTTCTAAAAGG + Intronic
1032289008 7:130569951-130569973 AAATCACTTCATCATTTCAATGG + Intronic
1033451576 7:141466741-141466763 AAATGCCTTGAACATCCCAAGGG + Intronic
1034764168 7:153702264-153702286 AAATGACTTTATCATATTTATGG + Intergenic
1035309718 7:157958240-157958262 AAATCACCTCAACATAATAAAGG + Intronic
1035890117 8:3334154-3334176 AAATGACATCAACCTTTTCAAGG + Intronic
1035947904 8:3985737-3985759 AAATCACTTTAACATTTTAAAGG - Intronic
1037113229 8:15191828-15191850 AAATGACTCTAAAATATTAAAGG + Intronic
1038201324 8:25415739-25415761 GAATGATTTCATCAACTTAAGGG - Intronic
1039624065 8:39029536-39029558 AAATCACTTCAATATAATAAAGG - Intronic
1041997255 8:64077882-64077904 AATTTACTTCCACATATTAAAGG + Intergenic
1042260798 8:66857375-66857397 TAATGACTTGAACATTTTAAGGG + Intronic
1042482588 8:69321062-69321084 AAATCACATAATCATCTTAATGG + Intergenic
1043366674 8:79541365-79541387 AAATGACTTGCACATTTTTAAGG + Intergenic
1043669801 8:82869225-82869247 AAATGACTCCAGCATTGTAAAGG + Intergenic
1043747551 8:83894618-83894640 AAATAACCTCAGAATCTTAATGG - Intergenic
1043974378 8:86568264-86568286 AAATGAAATCCACTTCTTAATGG - Intronic
1044720425 8:95140207-95140229 AGATGACTTCAAAGGCTTAAGGG - Intronic
1044751936 8:95424435-95424457 ATCTGAATTCACCATCTTAATGG - Intergenic
1045448934 8:102299919-102299941 AAATAATTTTAACATTTTAAAGG - Intronic
1045792346 8:105998393-105998415 GGATGACTTCACCTTCTTAAAGG - Intergenic
1045972394 8:108093616-108093638 AAATGCCTTCAAAATACTAAAGG - Intergenic
1046353934 8:113053966-113053988 GACTCAGTTCAACATCTTAATGG + Intronic
1046517396 8:115281052-115281074 AAATTACATCAACATAATAAAGG + Intergenic
1046719371 8:117601754-117601776 AAATCACTACAAAAACTTAATGG - Intergenic
1047099283 8:121658310-121658332 AAATTACTTCAACTTAATAAAGG - Intergenic
1047690435 8:127347509-127347531 AAAGGACTTCTGCATCTTAAAGG - Intergenic
1048690404 8:136956073-136956095 AAATTACTTGAGCATATTAAAGG + Intergenic
1049124155 8:140771536-140771558 TAATGACTGCTGCATCTTAAAGG - Intronic
1050198732 9:3117102-3117124 AAATTACCTCAACATAATAAAGG - Intergenic
1051671903 9:19518920-19518942 AAATATTTTGAACATCTTAATGG - Intronic
1051796687 9:20879566-20879588 AAATGTCCTCAACAGCTGAATGG - Intronic
1051846793 9:21460404-21460426 AAATTACCTCAACATGATAAGGG - Intergenic
1051892982 9:21961797-21961819 AAATGCCTTAAAGATATTAATGG + Intronic
1052226246 9:26091426-26091448 TTATGACTTCAACATCTTTTGGG - Intergenic
1052792109 9:32885408-32885430 AAATCCCTTCAACATTTTTATGG + Intergenic
1053677807 9:40454503-40454525 AAATGACTTCAAAATATTTCTGG + Intergenic
1053927724 9:43082338-43082360 AAATGACTTCAAAATATTTGTGG + Intergenic
1054285919 9:63170452-63170474 AAATGACTTCAAAATATTTCTGG - Intergenic
1054290880 9:63290029-63290051 AAATGACTTCAAAATATTTCTGG + Intergenic
1054388901 9:64594576-64594598 AAATGACTTCAAAATATTTCTGG + Intergenic
1054506816 9:65921795-65921817 AAATGACTTCAAAATATTTCTGG - Intergenic
1055055464 9:72019628-72019650 CAATTACTTCAAAATCTTTAAGG - Intergenic
1055232431 9:74082073-74082095 AAATTACCTCAACATGGTAAAGG + Intergenic
1055996517 9:82166245-82166267 TAAGGACTTCAACATATGAATGG - Intergenic
1056734137 9:89191013-89191035 AAAAGACTTCAACATCTCCATGG + Intergenic
1057300598 9:93879466-93879488 AAATGTCCTCAACATGATAAAGG + Intergenic
1058094649 9:100845948-100845970 AGATCAGTTAAACATCTTAAAGG + Intergenic
1058268107 9:102932985-102933007 ACATGCCTTCAAAATCTCAAAGG + Intergenic
1058514732 9:105758870-105758892 AAATTTCTTCAACATCTTCCTGG - Intronic
1058927972 9:109687255-109687277 GCATGACTTCAACATTTCAAAGG - Intronic
1059508852 9:114825235-114825257 AAATGACTCCAGCATCCTCAAGG - Intergenic
1059615112 9:115941876-115941898 AAAAGACTCCAACATATTCAAGG - Intergenic
1059973056 9:119687194-119687216 AAATAAATTCTACATCTTCAGGG - Intergenic
1060138228 9:121178736-121178758 AAAAGACTTCAACATTGTACTGG + Exonic
1060141012 9:121210120-121210142 AAATGACTCCAAAATCTCAGCGG + Intronic
1186195085 X:7102428-7102450 AAACTACCTCAACATATTAAAGG + Intronic
1186365328 X:8886534-8886556 ACTTGACATTAACATCTTAATGG + Intergenic
1186578517 X:10791945-10791967 AAATGCTTTCATCATCTTCATGG + Intronic
1186926722 X:14341513-14341535 CAAACACATCAACATCTTAAAGG + Intergenic
1187390060 X:18880094-18880116 AGATGACTTCATCATCTTGGTGG - Intergenic
1187776596 X:22766511-22766533 TAATGACGGCAAAATCTTAAGGG - Intergenic
1188250787 X:27891577-27891599 AAATTACCTCAACATGATAAAGG - Intergenic
1188819486 X:34756715-34756737 AAAGGACTCCAACAATTTAATGG - Intergenic
1189221116 X:39372998-39373020 AAATCACATCAACATTTTGAAGG - Intergenic
1190139035 X:47825200-47825222 AAATGACAGCAACATTATAAAGG + Intergenic
1190584102 X:51920377-51920399 AATTGAAAGCAACATCTTAATGG - Intergenic
1191779693 X:64852322-64852344 AAATGGATTCAACATGTTTATGG + Intergenic
1191976311 X:66875592-66875614 AAATGACTTAATCTTTTTAATGG + Intergenic
1193569308 X:83122799-83122821 GAATGACTTCAAGAGCTTAAAGG + Intergenic
1193826178 X:86230207-86230229 AAATCACGTGATCATCTTAAAGG - Intronic
1193878268 X:86890318-86890340 AACTGACTAGAACATTTTAAAGG + Intergenic
1194957431 X:100197536-100197558 ATATGAATTGAACATCTCAACGG + Intergenic
1196076376 X:111581385-111581407 AAATTACTTCAACATAATCAAGG - Intergenic
1196124860 X:112086273-112086295 AAATGACTACAACATCACAAAGG + Intergenic
1198732844 X:139752095-139752117 GAATAACGTCGACATCTTAAAGG - Intronic
1198733039 X:139754315-139754337 TAATGACTTCAAAAACTGAAAGG + Intronic
1199249393 X:145642196-145642218 AAATTACTTCAACATAATAAAGG + Intergenic
1199512382 X:148636924-148636946 AAATGACTTCATCTTGTAAAAGG + Intronic
1199683487 X:150243643-150243665 AACTGACTAATACATCTTAATGG - Intergenic
1200053998 X:153449204-153449226 TAATGACTTCAACATGTAAAAGG - Intronic
1201451195 Y:14116549-14116571 AATTGACTGCATCATCTGAAAGG + Intergenic