ID: 1023452769

View in Genome Browser
Species Human (GRCh38)
Location 7:40305059-40305081
Sequence CAGGGTGAAGAAAGGAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1311
Summary {0: 1, 1: 0, 2: 5, 3: 125, 4: 1180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023452769 Original CRISPR CAGGGTGAAGAAAGGAGGAA AGG (reversed) Intronic
900006526 1:58238-58260 CAGGTTGAAGAAATAAGAAAGGG + Intergenic
900113693 1:1019967-1019989 GAGGGGGAAGGAAGGAGGAGGGG + Intergenic
900391661 1:2436417-2436439 GAGGAGGGAGAAAGGAGGAAAGG - Intronic
900573190 1:3370005-3370027 CAGGGAGAAGAAAGAAGGATGGG + Intronic
900711717 1:4118817-4118839 CTGGCTGTAGAATGGAGGAAGGG + Intergenic
900827382 1:4937664-4937686 CAGAGGGAAGGAAGGAGGGAGGG + Intergenic
900849354 1:5130374-5130396 GAGGGTGGAGACACGAGGAAGGG + Intergenic
900885506 1:5412588-5412610 ATGGGTGATGAAAGGAGAAATGG - Intergenic
901253108 1:7796672-7796694 GAGGGGGAAGAAGGGAGGCAGGG + Intronic
901469208 1:9443938-9443960 CATGGTGAAGGAAAGAGGAGGGG - Intergenic
902130531 1:14256499-14256521 CAGAGAGAGGAAAGGAGGGAGGG + Intergenic
902795942 1:18800373-18800395 CAGGAGGAAGGAAGAAGGAAAGG - Intergenic
903025707 1:20428681-20428703 CAGAGAGAAGGAGGGAGGAAGGG + Intergenic
903149678 1:21397968-21397990 GAGAGGGAGGAAAGGAGGAAGGG - Intergenic
903223527 1:21882088-21882110 CAGGGTAAAGAAAGGACAAGGGG + Intronic
903234993 1:21944389-21944411 CAGGCTGAAGGAAGGAACAAGGG - Intergenic
903331618 1:22599782-22599804 GAGGGAAAAGAAAGGAGGGAAGG + Intronic
903382950 1:22909363-22909385 CAGGGGGTAGGAAGTAGGAAAGG + Intronic
903782328 1:25828746-25828768 CAGAGTGAAAAAATGAGGATGGG - Intronic
904067155 1:27762189-27762211 CAGGGTTAAGAAGGGAAGATAGG - Intronic
904149721 1:28427699-28427721 CAGAGTAAAAAAGGGAGGAAAGG - Intronic
904480757 1:30791793-30791815 GAGAGGGAAGGAAGGAGGAAGGG + Intergenic
904577711 1:31515726-31515748 CAGGGTCAGGAGTGGAGGAAGGG + Intergenic
904787854 1:32996027-32996049 AAGGAAGAAGAAAGGAGGAAGGG - Intergenic
904992372 1:34603556-34603578 AAGGGGGAAGAAAAGAGAAATGG - Intergenic
905217388 1:36418611-36418633 TAAGATGAGGAAAGGAGGAAGGG + Intronic
905275519 1:36815382-36815404 CTGAGTGAAGAGAGAAGGAAGGG - Intronic
905469301 1:38179765-38179787 AAGGGTGAAGGAAGCAGGATTGG - Intergenic
905605963 1:39300394-39300416 CAGGGGGAAGGAAGAAAGAAGGG + Intronic
906300846 1:44680557-44680579 GGGGGTGAAGCAAGTAGGAAGGG + Intronic
906750707 1:48257139-48257161 CTGGGAAAAGAAGGGAGGAAAGG + Intergenic
906920734 1:50061851-50061873 GAGGGTGAAGAAAGTAGAATTGG - Intronic
907225082 1:52938548-52938570 CAATGTGAAGAAATGATGAAAGG - Intronic
907285365 1:53376400-53376422 CAGGGTGAGGACAGGAGGAGGGG + Intergenic
907336904 1:53705707-53705729 GAGGCAGAAGAAGGGAGGAAAGG + Intronic
907678081 1:56537291-56537313 GGGGGTGTGGAAAGGAGGAATGG - Intronic
907832077 1:58074175-58074197 AAGGTTGCAGATAGGAGGAAGGG + Intronic
907903908 1:58766825-58766847 CAGGGAGAAGGAAGGAGGGCAGG - Intergenic
907918117 1:58889148-58889170 AAGGCTGAAGAAAGGAAGACCGG - Intergenic
908101791 1:60798681-60798703 GAGGGTGAAGAAAGGATGTTGGG - Intergenic
908434471 1:64091733-64091755 CATGGAGAAGAAAGGAAGCAAGG - Intronic
908436571 1:64112727-64112749 GATGGTGAGGGAAGGAGGAAGGG - Intronic
908574505 1:65444667-65444689 AAAGGAGAGGAAAGGAGGAAGGG + Intronic
908634820 1:66151574-66151596 CAGGGAGAAGAAACGAATAAAGG - Intronic
908641495 1:66228835-66228857 CAGGCAGAAAAAACGAGGAAAGG + Intronic
908654504 1:66373539-66373561 CGGGGTGAAGAGAGGAGGTAGGG - Exonic
909111571 1:71485162-71485184 GGAGGTAAAGAAAGGAGGAAAGG + Intronic
909237074 1:73166540-73166562 GAGAGTGAAGGAAGCAGGAAAGG - Intergenic
909434005 1:75619194-75619216 AAGGGAGAAGGAAGGAAGAAAGG + Intergenic
909666264 1:78136698-78136720 CAGTGGAAAGAAAGGAGGAAGGG + Exonic
910156191 1:84223254-84223276 CAGGGAGAAGAATTGAGGACAGG - Intronic
910352123 1:86309771-86309793 CAGGGTGAAGTTGGGAGTAAAGG - Intergenic
910459779 1:87436699-87436721 CAGGGAGCAGACAGCAGGAATGG - Intergenic
911167923 1:94741565-94741587 GAAGGTGAAGGAAGTAGGAAGGG + Intergenic
911256886 1:95643462-95643484 ATGGGTGAAGATAGGAGGAGGGG + Intergenic
911375561 1:97046741-97046763 CAGCATGAAGAAGGAAGGAAAGG - Intergenic
911577203 1:99592501-99592523 GAAAGAGAAGAAAGGAGGAAAGG + Intergenic
911888878 1:103341567-103341589 GAGGAGGAAGAAAGCAGGAAAGG - Intergenic
911897384 1:103454348-103454370 AAGGGTGAGAAAAGGAGAAAAGG + Intergenic
912134913 1:106649081-106649103 TAGGGTGAGGTATGGAGGAAAGG - Intergenic
912302190 1:108529665-108529687 AAGGTGGAAGAAAGGAGAAAAGG + Intergenic
912316153 1:108669014-108669036 GAGGGGGAAGAAAGAAGGAAGGG + Intergenic
912817331 1:112839677-112839699 GAGGGTGAAGAAGGGGAGAATGG - Intergenic
912843831 1:113062244-113062266 CAGGGTTAAAAAAGTAGAAATGG - Intergenic
912903192 1:113674940-113674962 CAGGCTGAATAAATGAGCAATGG + Intronic
913314921 1:117541504-117541526 GTGGGTGAAGAAAGAAGGAAAGG - Intergenic
913340542 1:117753742-117753764 CAGAGTGAAGAAGGGAAGAGTGG + Intergenic
913348570 1:117832215-117832237 CATGGTGAAAATAAGAGGAAGGG - Intergenic
913447627 1:118966577-118966599 CAGGGTAAGGAAATGAGGTACGG + Intronic
914433775 1:147642155-147642177 CAGGGGGAAGCATGGAGTAAAGG - Intronic
914724436 1:150315913-150315935 CAGAGGGAGGAAGGGAGGAAGGG - Intergenic
914754419 1:150554585-150554607 CAGGGAGAAGAAAGAAGGCATGG - Intronic
914960112 1:152197523-152197545 GAGAGAGAAGGAAGGAGGAAGGG - Intergenic
915331421 1:155115072-155115094 GAGGTTGCAGAAAGGAGGGAAGG - Intergenic
915604807 1:156943798-156943820 CTGGGTCAGGACAGGAGGAAAGG + Intronic
915740906 1:158117811-158117833 CAGGGAGAAGAGAGTAGGAGTGG + Intergenic
915917858 1:159951869-159951891 GGGGTGGAAGAAAGGAGGAAAGG + Intronic
917016136 1:170532636-170532658 CAGGGTAAGGGAAGGAGGAGGGG + Intronic
917157387 1:172019039-172019061 GGGAGGGAAGAAAGGAGGAAGGG - Intronic
917766232 1:178220312-178220334 CAAGGGGAAGAAAAGAGGCAAGG + Intronic
917879862 1:179324441-179324463 CAGGATGATGGAAGGAGGACAGG - Intronic
917995446 1:180433988-180434010 TAGGGTGAGGCATGGAGGAAGGG - Intronic
918102165 1:181385835-181385857 GAAGGTAAAGAGAGGAGGAAAGG - Intergenic
918247023 1:182669566-182669588 CAAGGTGGAGAAAAGAGGAAAGG + Intronic
918292535 1:183122646-183122668 CAGGGTGCAGAAAGGTGAACAGG - Intronic
918626592 1:186662779-186662801 CAGGGTGAAGGAAGATGAAAAGG + Intergenic
918695063 1:187534900-187534922 AAGGGTTAAGAAAGGAGCACTGG - Intergenic
919005444 1:191893234-191893256 GAGTGTCAAGAAAGTAGGAAAGG + Intergenic
919089410 1:192960448-192960470 GTAGGTGAAGAAAGGAGGAGAGG + Intergenic
919110182 1:193208753-193208775 CACAGAGAAGAAAGGAAGAATGG - Intronic
919518288 1:198554903-198554925 AAGAGGAAAGAAAGGAGGAAGGG - Intergenic
919632705 1:199974525-199974547 CTGAGTGAAGAAAGGAGAAAGGG + Intergenic
919640279 1:200039450-200039472 CAGGGTTAAAAAAGGAGGCGAGG - Intronic
920252229 1:204629351-204629373 GAGGGTGGAGGAAGGAGCAAGGG - Intronic
920301556 1:204992126-204992148 CAGGCTGGAGAAACGAGGCAGGG + Intronic
920356601 1:205377937-205377959 CAGGGTGAAGCATGTGGGAAGGG + Intergenic
920668381 1:207983411-207983433 CAGGGTGGGGAAGGGAGGAGAGG + Intergenic
920691711 1:208152005-208152027 CAGTCTGGAGAAAGGAGCAAAGG + Intronic
920729951 1:208474052-208474074 CAGTGTGTAGACAGGAGGTAGGG + Intergenic
920996235 1:210995251-210995273 CAAGGGGAAAAAAGGAAGAATGG - Intronic
921135647 1:212256903-212256925 CGGGGTGATTAAAGGAGAAAAGG - Intergenic
921254211 1:213325008-213325030 CTGGGTGCAGAAAGGGGGCAGGG - Intergenic
921325856 1:213985811-213985833 TAGGGGGAAGAAAGGAGTCAGGG - Intronic
921436374 1:215128213-215128235 CTGGGTGAAGAAAGTTGGAAAGG + Intronic
921583014 1:216916728-216916750 GAGGGTGAGGAGTGGAGGAATGG - Intronic
922158608 1:223060639-223060661 GACGGAGAAGAAAGGAGGATTGG - Intergenic
922475282 1:225902925-225902947 CAGGGGCTAGAGAGGAGGAAGGG + Intronic
922995159 1:229951587-229951609 AAGAGAGAAGAAGGGAGGAAGGG + Intergenic
924003010 1:239574549-239574571 CAGGAGGAAGGAAGGAGGACAGG - Intronic
924005122 1:239600676-239600698 AAGGGAGAAGAAAGGAAGGAAGG - Intronic
924026193 1:239835290-239835312 AAGGGGAAAGAAAGGAAGAAAGG - Intronic
924109801 1:240687457-240687479 CAGGGTGAGGAAAGGATGACAGG + Intergenic
924154728 1:241164159-241164181 TAGGGTGAGGTATGGAGGAAGGG + Intronic
924575386 1:245276396-245276418 CAGGGAGAAGTAAGGAGTTAGGG + Intronic
924711242 1:246531639-246531661 GAAAGTGAAGAAAGGAAGAACGG + Intergenic
924918246 1:248596945-248596967 CAAGGGGAAAAAAGGAGGAAAGG + Intergenic
1063570079 10:7207351-7207373 CACTGTCAAGAAAGGAAGAAAGG + Intronic
1063610112 10:7554528-7554550 CAGAGTCATGAAAAGAGGAAGGG + Intergenic
1063664214 10:8051901-8051923 CACGGGGAAGGAAGGGGGAAGGG - Intergenic
1063877712 10:10497539-10497561 CAGGTTAAAAAAAAGAGGAAAGG + Intergenic
1065134368 10:22653541-22653563 CAGACAGAAGAAAGGAGGTAGGG + Intronic
1065247271 10:23770993-23771015 CAAGGTGATGAAAGGAGAAAAGG - Intronic
1065517554 10:26539437-26539459 GAGAGTGAAGGAAGGAAGAAAGG + Intronic
1065602195 10:27380369-27380391 CAGGATGAGGAAAGGAGTAATGG + Intergenic
1066254110 10:33662105-33662127 CAGTGGGGAGACAGGAGGAAGGG - Intergenic
1066275617 10:33865639-33865661 CAGGGAAAAGAAAGGAAGGAAGG - Intergenic
1066487044 10:35856166-35856188 GAGGGAGAAGAAGGGAGGGAAGG - Intergenic
1066566351 10:36725606-36725628 CTGTGAGAAGGAAGGAGGAAGGG - Intergenic
1066569403 10:36754410-36754432 GAGGGGGAAGGAAGGAGGGAGGG + Intergenic
1066596425 10:37055152-37055174 CAGGCTGAGGAAAAAAGGAAGGG + Intergenic
1067111229 10:43401953-43401975 CAGAGAGATGGAAGGAGGAAAGG + Intronic
1067267933 10:44763351-44763373 ATGGGGAAAGAAAGGAGGAAGGG + Intergenic
1067355944 10:45526536-45526558 CAGGCTGAAGAGAGGAGGCCAGG + Intronic
1067678705 10:48411830-48411852 GAGGGTGGAGAAAGGAAGGAAGG - Intronic
1067905336 10:50284960-50284982 CAGGGTGAGGAAAGTTGGGAAGG - Intergenic
1068120557 10:52779239-52779261 GAGGGAGAAGCAAGGAAGAAAGG - Intergenic
1068150048 10:53120030-53120052 CAGTGTGAACAAAGGCAGAAAGG + Intergenic
1068549469 10:58389754-58389776 CTGGGTGCATTAAGGAGGAAGGG - Intronic
1068941679 10:62686890-62686912 CAGGGAGAAAAAAAGAGGCAAGG + Intergenic
1069953571 10:72036037-72036059 CAGGCTGGGGAAAGGAGGGAAGG - Intergenic
1070248897 10:74756379-74756401 CAGGGTAAAGAGGGGAGGAGAGG + Intergenic
1070312545 10:75284158-75284180 GAGGGAGAAGAAGGGAGGGAAGG + Intergenic
1070343974 10:75523801-75523823 CAGAGAGAAGAAAGGATGCAGGG - Intronic
1070396233 10:76013324-76013346 CTGGATGTAGAAAAGAGGAAGGG + Intronic
1070484277 10:76914631-76914653 AATGGAGAGGAAAGGAGGAAAGG - Intronic
1070520207 10:77246043-77246065 CAGGGTGAGAAATGGAGAAAGGG + Intronic
1070571444 10:77642124-77642146 CAGGGAGTAGGAAGGAGGCATGG + Intergenic
1070706193 10:78640625-78640647 CAGGGCCCAGAAAGGAGAAATGG - Intergenic
1070745745 10:78932646-78932668 AAGGGGGAAGAAAAGAGAAAGGG + Intergenic
1070860954 10:79660768-79660790 CAGGATGTAGGAAGGTGGAAAGG - Intergenic
1070876308 10:79814817-79814839 CAGGATGTAGGAAGGTGGAAAGG + Intergenic
1070950623 10:80428207-80428229 GAAGGTGTGGAAAGGAGGAATGG + Intronic
1071268401 10:83984582-83984604 CAGGGAGAAGAAATCAGGGAAGG + Intergenic
1071517302 10:86306639-86306661 AGCAGTGAAGAAAGGAGGAAGGG + Intronic
1071532718 10:86401503-86401525 CAAGGGGAAGAAAGAGGGAAAGG - Intergenic
1071643238 10:87336990-87337012 CAGGATGTAGGAAGGTGGAAAGG + Intergenic
1071766133 10:88667729-88667751 AAGGAAGAAGAAAGAAGGAAAGG - Intronic
1071777576 10:88806373-88806395 GAGAGTGAAGGAAGGAGCAAAGG - Intronic
1072710620 10:97713715-97713737 AAGGGTGGGGAAAGGAGGAGAGG + Exonic
1072736459 10:97882671-97882693 CAAGGGGCAGAAAGGAGGACAGG - Intronic
1073484744 10:103809643-103809665 GAGGGAGAGGGAAGGAGGAAAGG - Intronic
1073625377 10:105091168-105091190 AGGGATGAAGGAAGGAGGAAAGG - Intronic
1073870817 10:107862157-107862179 CATGGTGAAGAACAGAGGACAGG + Intergenic
1073911965 10:108356570-108356592 CAGGGTGATAATAGTAGGAAAGG - Intergenic
1074287818 10:112115162-112115184 CTGGGAGAAGAAAGCAGGAAAGG + Intergenic
1074399155 10:113127385-113127407 GAGGTTCAAGAAGGGAGGAAGGG - Intronic
1074496893 10:113987279-113987301 AAGGGGGAGGAAAGAAGGAAAGG + Intergenic
1074724072 10:116289651-116289673 CAGAGAGAAGGAAGGAGGAAGGG - Intergenic
1074753334 10:116607507-116607529 CAGGGAGTAGGAGGGAGGAAGGG + Intronic
1075080850 10:119382544-119382566 CAGAGTAAAGGATGGAGGAATGG - Intronic
1075114957 10:119618498-119618520 CTGTGTGAAGTAAGGTGGAAAGG - Intergenic
1075324526 10:121520178-121520200 GAGAGGGAAGAAAGGAGGAGTGG + Intronic
1075564010 10:123490637-123490659 CAGGGTGGAGAGGGGAGGGAGGG - Intergenic
1075863538 10:125697972-125697994 GTGGTTGAAGAAAGGAGAAAAGG + Intergenic
1075929501 10:126283639-126283661 GAGGAGGAAGAAAGCAGGAAAGG - Intronic
1075934859 10:126331717-126331739 CATGGGGAAGGAAGGAGGGAGGG + Intronic
1075980963 10:126739161-126739183 CAGCCTGAAGTCAGGAGGAAGGG + Intergenic
1076186989 10:128457881-128457903 CAGGAAGAAGAAAGGAGAAAGGG - Intergenic
1076516150 10:131045452-131045474 AAGGGAGAAGAAAGGAGGAAGGG + Intergenic
1076617284 10:131763892-131763914 CAGGGTGCAAAGAAGAGGAAAGG + Intergenic
1076626521 10:131824487-131824509 CAGGGTGAAGAGGGGAGCCATGG + Intergenic
1076835067 10:133016884-133016906 CAGCGGGAAGGAAGGAGGGAAGG - Intergenic
1077063741 11:628996-629018 AAGGAAGAAGAAAGGAAGAAAGG - Intergenic
1077307166 11:1873590-1873612 GAGGATGGAGAAGGGAGGAAGGG + Intronic
1077443755 11:2580769-2580791 CAGGCTGAAGAAAGCAGGGGTGG - Intronic
1077702361 11:4454212-4454234 CTGGGTGCAGCAAGGAGGGAAGG - Intergenic
1078379005 11:10822859-10822881 CAGGGTGAGGTATGGGGGAAGGG - Intronic
1078434035 11:11309868-11309890 CAGGGTGAGGAGAGGTGGGATGG - Intronic
1078710572 11:13786995-13787017 CAGAGTGAAGAAGAGAGGATTGG + Intergenic
1078807929 11:14725449-14725471 CAGAGGGAGGAAAGGAGGGAGGG - Intronic
1078823156 11:14903255-14903277 GGGAGTGAAGAAAGTAGGAATGG - Intergenic
1078844468 11:15108862-15108884 CAGGGTCAAGTAAAGAGGCAGGG + Intergenic
1079017056 11:16878101-16878123 GAGGTTAAAGAAAGGAGTAAAGG - Intronic
1079694816 11:23468157-23468179 CAGAGTGAAGAATGAAGAAACGG + Intergenic
1080052270 11:27869811-27869833 TAGGGTGAAGAAGGCAGCAATGG - Intergenic
1080609104 11:33888465-33888487 CAGAGGGAGGGAAGGAGGAAGGG - Intronic
1080891586 11:36413222-36413244 GAGAGTGAAGAGATGAGGAAAGG - Intronic
1080940196 11:36908109-36908131 GATGCTGAAGAAAGGAGAAAAGG + Intergenic
1081082967 11:38766490-38766512 GAGAGAGAAGAAAGGAGGAAAGG + Intergenic
1081264071 11:40997518-40997540 TAAGGTGAAGAATGAAGGAAAGG + Intronic
1081641681 11:44759994-44760016 CAGGGTTAGGAAAGGAAGAGAGG + Intronic
1082244453 11:49905242-49905264 GAGGGGGAAGTGAGGAGGAAGGG + Intergenic
1082561998 11:54628823-54628845 GAGGGTGAAGGAAGGAGATATGG - Intergenic
1082812660 11:57487942-57487964 CAGAGTGAACAATGGAGGAGGGG + Intronic
1082852232 11:57775700-57775722 CAGAGTTAACCAAGGAGGAAGGG - Intronic
1083039918 11:59675962-59675984 CAGGGAGAGGTATGGAGGAAGGG - Intergenic
1083063490 11:59898867-59898889 CAGGGTAAATAAAGCAGGAGTGG + Intergenic
1083142136 11:60730676-60730698 CAGGATTAAATAAGGAGGAATGG - Intronic
1083170997 11:60924119-60924141 CAGGGACAGGAAAGGAGGGAGGG - Intergenic
1083372400 11:62192644-62192666 CAGGGAGAAGAAGGCAGGGAGGG + Intronic
1083440026 11:62669996-62670018 CAGGGAGAAGCAAGGAGGATGGG - Exonic
1083489036 11:63001222-63001244 CAGGATGAAGAGAGGTGGCAAGG - Intronic
1083501820 11:63115840-63115862 CAAGGTGAGGACAGAAGGAATGG - Intronic
1084068984 11:66721559-66721581 CGGGGTGAAGAAAGGGGTGATGG + Intronic
1084302361 11:68259905-68259927 GAGGGAGAAGACAGGAGGAGAGG + Intergenic
1084719438 11:70894813-70894835 CACAGTGAAGAAGGGAGGTAAGG - Intronic
1084742741 11:71150020-71150042 GAGGGAGAGGAAAGGAGGGAGGG + Intronic
1084742747 11:71150038-71150060 GAGGGAGAGGAAAGGAGGGAGGG + Intronic
1084742753 11:71150056-71150078 GAGGGAGAGGAAAGGAGGGAGGG + Intronic
1084972709 11:72780533-72780555 CAGGGTGCAGAAAGCGGGGAAGG + Intronic
1085261810 11:75209979-75210001 CCTGGTGAAGAAGGCAGGAAAGG + Intergenic
1085409903 11:76284693-76284715 CAGGGTGAAGACAGCAGGGCGGG + Intergenic
1085555053 11:77412001-77412023 GCGGGGGAAGAAAGGAGGGAAGG + Intronic
1086156758 11:83675832-83675854 AGGGGAGAAGAAAGAAGGAAAGG - Intronic
1086184818 11:84000412-84000434 GAAGATGAAGAAAGGATGAAAGG + Intronic
1086749864 11:90478305-90478327 CAGTGGGGAGAAAGAAGGAAAGG + Intergenic
1086937924 11:92764745-92764767 CAAGGGGAAGAAAGGAGCAGAGG - Intronic
1086994094 11:93336766-93336788 CAGCCTGAAAACAGGAGGAATGG - Intronic
1087385686 11:97465211-97465233 CAAGGGAAAGAAAGGAGGATGGG + Intergenic
1087527174 11:99330231-99330253 AAGGAGGAAGAAAGGAGGGAGGG + Intronic
1087676611 11:101169755-101169777 AAGGTCGAAGAAAGGAGGCAAGG + Intergenic
1087990745 11:104743588-104743610 CGGGGAGAAGGAAGGAGGGAAGG + Intergenic
1088249203 11:107848285-107848307 AAGGGTGAGGAGAGGAGGAGGGG + Intronic
1088483506 11:110319318-110319340 AAGGGTGAAGGAAGGAGGAAAGG + Intergenic
1088515429 11:110627461-110627483 CAGTATGAAGATAGGAGGATAGG - Intronic
1088523049 11:110719928-110719950 GAGGAGGAAGAAAGGAGAAAAGG + Intergenic
1088560873 11:111114968-111114990 CAGGTAGTAGAAGGGAGGAAGGG - Intergenic
1088728476 11:112659844-112659866 CAGGTGGAAGAAAGAAGGAGGGG + Intergenic
1088871694 11:113895799-113895821 CTGGGTGAAGAGAGGGTGAACGG - Intergenic
1088935466 11:114395414-114395436 CTGGGGGAATTAAGGAGGAAAGG + Intronic
1089100432 11:115958317-115958339 AAGAGGGAAGAAAGGAGGGAAGG - Intergenic
1089585310 11:119506818-119506840 CAGGGTGAGGTATGGGGGAAGGG + Intergenic
1089678205 11:120104719-120104741 CTGGGTGGAGAAGGGAGGGAAGG - Intergenic
1089704309 11:120266385-120266407 CAGGGGTAAGAGAAGAGGAAGGG - Intronic
1089947672 11:122494384-122494406 CAGGGTGGAGAAAGGCGCCAGGG - Intergenic
1090624062 11:128590371-128590393 CAGGTTGGAGAAAGGAGAATGGG + Intergenic
1090714842 11:129421397-129421419 CCTGTTGAAGTAAGGAGGAAAGG - Intronic
1090873207 11:130766307-130766329 CAGGGCGAACAAAGGAAGAGAGG - Intergenic
1090964462 11:131585869-131585891 CAGGGAGAAGAAAGGAAAGATGG - Intronic
1091113805 11:132995453-132995475 CAGAGGGAAGAAGGGAGGGAGGG - Intronic
1091209383 11:133843559-133843581 AAGGAGGAAGAGAGGAGGAAGGG + Intronic
1091241202 11:134053620-134053642 CAGGTGGAAGGAAGGAGGACAGG + Intergenic
1091451569 12:575488-575510 CAGGGTCTAGAAAGGAGGGGAGG - Intronic
1091848221 12:3674037-3674059 CAGGAAGAAGACAGGAGGACAGG + Intronic
1091860506 12:3777236-3777258 CAGAGGGAAGGAAGGAGGGAAGG + Intergenic
1091870432 12:3885596-3885618 TAGGGTGCAGAAAGGAGTAGTGG + Intergenic
1091998127 12:5011190-5011212 CAGGGATAGGAAAGGAGGATGGG - Intergenic
1092173939 12:6390353-6390375 CAGGGAGAAGAGAGGAAGGATGG + Intronic
1092380765 12:7995200-7995222 CAGGGAGAAGATAAAAGGAAAGG - Intergenic
1092735621 12:11579770-11579792 CTGGGAGAAGAAGGGTGGAATGG - Intergenic
1092889610 12:12956390-12956412 AAGAGAGAAGAAAGAAGGAAGGG - Intergenic
1092904340 12:13088410-13088432 AAGAGTGAAGAAGGGAGGCAGGG - Intronic
1092999319 12:13980637-13980659 AAGTGGGAAGGAAGGAGGAAGGG + Intergenic
1093108063 12:15113130-15113152 CAGGGTGAAGATGGGGGAAAAGG + Intronic
1093141309 12:15513258-15513280 GAGGGGGAAGGAAGGAGGGAGGG + Intronic
1093308528 12:17548361-17548383 CTGTGTGTATAAAGGAGGAATGG + Intergenic
1093750805 12:22797728-22797750 CAGAGGGAAGGTAGGAGGAAGGG + Intergenic
1094195253 12:27742640-27742662 CAGGGCCAAGAAAGGAGGTGAGG + Intronic
1094232437 12:28122463-28122485 AAGAGAGAAGAAAGGAGGGAAGG + Intergenic
1094306800 12:29029300-29029322 GAGGGTGAAGAAATGAGGACTGG - Intergenic
1095305502 12:40634199-40634221 CAGTGTGTAGGAAAGAGGAAAGG + Intergenic
1095838120 12:46661023-46661045 CAGGGTTAAGAAAGGAACAAAGG + Intergenic
1095897507 12:47294719-47294741 CAGGGGAAAGGAGGGAGGAATGG - Intergenic
1096224312 12:49855396-49855418 AAGGATGAAAAAAGGAGGGAAGG - Intergenic
1096464000 12:51838193-51838215 CTGGGGGAAGAAAGGAGTAAGGG + Intergenic
1096557286 12:52411190-52411212 CAGGGGGAAGAAAGGAGGTGAGG + Intergenic
1096753132 12:53775989-53776011 CAGGGAGTAGAAGGGAGGGAAGG + Intergenic
1096815600 12:54199991-54200013 AAAGGGGAAGAAAGAAGGAAGGG + Intergenic
1096883771 12:54696573-54696595 CAAGGAGAAGAAAGAGGGAAGGG - Intergenic
1096994623 12:55830872-55830894 CAGGGTGGAGAAAGGGGACAGGG - Intergenic
1097037920 12:56136291-56136313 CAGAATGAACAAAGGTGGAAGGG + Intronic
1097055683 12:56247808-56247830 CAGGAGGAAGAAGGGAGGCAAGG + Intronic
1097350597 12:58544447-58544469 CAGAGAGGAGAAAGGAAGAAGGG - Intronic
1098344228 12:69484561-69484583 CAGGGAGCAGACAGGAAGAAAGG - Intronic
1098603988 12:72367614-72367636 CAGGGTGATACAAAGAGGAAAGG - Intronic
1098815556 12:75157277-75157299 CAGAGTTAAGCAAGAAGGAAGGG - Intronic
1098913214 12:76231816-76231838 CAAGAGGAAGAAAGGAGCAAAGG - Intergenic
1099054238 12:77818081-77818103 TAGGTGGAAGAGAGGAGGAAAGG + Intergenic
1099336498 12:81366068-81366090 GAGGGGGAAGAAAGAAGGGAGGG - Intronic
1099342553 12:81455931-81455953 AGGGGTGTAGAAAGGAGTAAGGG + Intronic
1099393531 12:82110005-82110027 AAGGATGAAGAAAGGAAGAGAGG + Intergenic
1099681567 12:85836275-85836297 CAGGGTGAAGGGAGGAGGGCTGG + Exonic
1100128247 12:91456918-91456940 CAGGGAGAAGAAAGAATAAATGG - Intergenic
1100275631 12:93069268-93069290 CAGGGAGGAGAGAGGAAGAAAGG + Intergenic
1100324729 12:93530239-93530261 GAGGAAGAGGAAAGGAGGAAAGG - Intergenic
1100384980 12:94097677-94097699 CAGGGTGGAGGAGAGAGGAATGG - Intergenic
1100535695 12:95506659-95506681 CAGGGTCTAGGCAGGAGGAAGGG - Intronic
1100550704 12:95644248-95644270 AAGGAGGAAGAAAGGAGGAGGGG - Intergenic
1100606408 12:96155342-96155364 TAGGCTGAAGAAAGGAGGGTGGG - Intergenic
1101011563 12:100456244-100456266 GAGGGTGAAGAAAAAAGCAAAGG - Intergenic
1101042133 12:100767277-100767299 CACAGTTAAGAAAGGAAGAATGG - Intronic
1101161953 12:101986571-101986593 AAGGGTGAAGAAAGGAAGATGGG + Intronic
1101269444 12:103128271-103128293 AAGGGGGAAGAAAGAAGAAAAGG + Intergenic
1101348217 12:103905426-103905448 GAGGGAGAAGAAAGGAAGGAAGG + Intergenic
1101348265 12:103905556-103905578 GAGGGAGAAGAAAGGAAGGAAGG + Intergenic
1101348278 12:103905606-103905628 GAGGGAGAAGAAAGGAAGGAAGG + Intergenic
1101348304 12:103905673-103905695 GAGGGAGAAGAAAGGAAGGAAGG + Intergenic
1101390988 12:104300246-104300268 AAGGGTGAAGAAAAGAGGAAAGG + Intronic
1101427680 12:104601118-104601140 GAGGGAGGAGGAAGGAGGAAGGG - Intronic
1101548656 12:105740963-105740985 CAGGCGGAAGAAAGGATGGAAGG + Intergenic
1101709587 12:107252727-107252749 CTGAGGGAAGAAAGGAGGAAAGG - Intergenic
1102513161 12:113429139-113429161 CCCTGTGCAGAAAGGAGGAAAGG - Exonic
1102699933 12:114830290-114830312 CAGAGGGAAGGAAGGAAGAAAGG - Intergenic
1102745220 12:115243931-115243953 AAGGGAGAAGAAAGAAGGAGAGG + Intergenic
1102859090 12:116319956-116319978 CAGGGAGGAGAAAGGAGCAGGGG + Intergenic
1102881319 12:116487210-116487232 GAGGGGGAAGGAAGGAGGACTGG + Intergenic
1103396975 12:120615085-120615107 CAGGGTGATTCAATGAGGAAAGG - Intergenic
1103443807 12:120981135-120981157 CAGGGTCAGGAAAGGAGCCAGGG + Intronic
1103491464 12:121324328-121324350 CAAGATGAAGAAAGGGGTAAAGG + Intronic
1103501564 12:121407061-121407083 GAGGGGGAAGGAGGGAGGAAAGG - Intronic
1103586646 12:121961245-121961267 GGGGGAGAAGAAAGGAGGGAGGG - Intronic
1103941432 12:124503375-124503397 GATGGAGGAGAAAGGAGGAAGGG + Intronic
1104225112 12:126823949-126823971 CATGGTTAAAACAGGAGGAAAGG - Intergenic
1104315741 12:127699174-127699196 CAGGCTGAAGGAAGGAAGATCGG - Intergenic
1104464870 12:128982201-128982223 CAGCATGAAGAAGGGAGGGAGGG - Intronic
1105353828 13:19639691-19639713 CAGGGGTAAGAGAGGAGGGAAGG + Intronic
1105432550 13:20350491-20350513 CAGGAGGGAGACAGGAGGAATGG + Intergenic
1105491458 13:20892483-20892505 AAGGATGAATAAACGAGGAAGGG - Intronic
1105587277 13:21756858-21756880 CAGGGTGAAGTCAGGGGGCAGGG - Intergenic
1105752273 13:23432414-23432436 GAAGGAGAAGAAAGGATGAAAGG + Intronic
1105997355 13:25685517-25685539 CAAGGGAAATAAAGGAGGAAAGG + Intronic
1106173141 13:27306456-27306478 CAGGATGAGGAAGGGTGGAACGG - Intergenic
1106230269 13:27815997-27816019 CAGAGTGAGGGAAGGAGGGAAGG - Intergenic
1106722362 13:32448656-32448678 AAAGCTGAAGAAAGCAGGAAGGG + Intronic
1106826178 13:33523119-33523141 CATGGAGAAGTCAGGAGGAAAGG - Intergenic
1106931209 13:34667805-34667827 CAGGGTGAAAAAAGCAGGAGTGG + Intergenic
1107080020 13:36364892-36364914 CAGTGTGGAGAATGGATGAAGGG - Intronic
1107627798 13:42307673-42307695 CAGGGAGAACATAGGAGGAGTGG + Intronic
1108405133 13:50093268-50093290 TAGTTTGAAGAAATGAGGAATGG + Intronic
1108418650 13:50226865-50226887 CAGGGTCAAGAAAGCAATAAAGG - Intronic
1108465252 13:50708562-50708584 CAGTGTGAAGAAAGGAGACAGGG + Intronic
1108732637 13:53250863-53250885 CAAAGTGAAGACAGAAGGAAAGG + Intergenic
1109181603 13:59220181-59220203 CAGAGAGAAGCAAGGAAGAAGGG + Intergenic
1109347760 13:61136465-61136487 CAGGTAGGAGGAAGGAGGAAAGG + Intergenic
1109476430 13:62885675-62885697 GAGGGTGGAGAGAGGAAGAAGGG - Intergenic
1109743759 13:66592328-66592350 TGGGGGGAAGAAAGGAAGAAAGG + Intronic
1109979966 13:69894854-69894876 TAGGGTGAAGAAGGTGGGAAAGG - Intronic
1110290234 13:73797352-73797374 TAAGATGAAGAAAGAAGGAATGG - Intronic
1110333366 13:74298288-74298310 CAGGGAGAAGAAAGGAACATGGG + Intergenic
1110830315 13:80023664-80023686 CAAGGAGTAGAAAGGAGAAAGGG - Intergenic
1110889806 13:80684767-80684789 GAGGGGGAGGAAGGGAGGAAGGG - Intergenic
1111150285 13:84244568-84244590 CAGGCAGAAGGAAAGAGGAAAGG - Intergenic
1111452604 13:88438694-88438716 CAGAGGGAGGAAGGGAGGAAGGG + Intergenic
1111716428 13:91885419-91885441 GAGGGGGAAGAAACAAGGAAAGG - Intronic
1112161580 13:96873989-96874011 GAGGGTGAAGTAAGCAAGAAGGG - Intergenic
1112503687 13:99960469-99960491 AAGAATGAAGAAAGGAGGATAGG - Intergenic
1113026400 13:105945829-105945851 CAGAGTGAACTAAGGTGGAAAGG - Intergenic
1113618503 13:111697402-111697424 CAGGGAGAGGAAGGGAGGCAGGG - Intergenic
1113624032 13:111782663-111782685 CAGGGAGAGGAAGGGAGGCAGGG - Intergenic
1113718201 13:112529566-112529588 CAGGGTGAAGGACGCAGGAGCGG - Intronic
1114423229 14:22602048-22602070 GGGGGAGAAGGAAGGAGGAAGGG - Intronic
1114482415 14:23044061-23044083 CAAAGGGAAGAAAGGAGGAGGGG - Exonic
1114496753 14:23138104-23138126 AAGGGTGGAGATAGGAGAAACGG - Intronic
1114762348 14:25330219-25330241 CAGGGTCAAGGAAGGAGCCATGG + Intergenic
1114859221 14:26494406-26494428 CACTTTGAAGAAAAGAGGAAAGG - Intronic
1115904636 14:38191907-38191929 CAGGGTGCAGAAATAAGGGATGG - Intergenic
1116273823 14:42805403-42805425 CAGGGAGAGGAAAGGGGAAAGGG + Intergenic
1116635507 14:47389727-47389749 CAGGGTGAAAAAAGGGGGGAGGG + Intronic
1117047570 14:51828461-51828483 CAGGAGGAAAAAAGGAGGGAAGG + Intronic
1117161848 14:52997341-52997363 GAAGGGGAAGAAAGGAGAAAAGG + Intergenic
1117839995 14:59850027-59850049 GAGGGTGAAGAGAGGAGCAATGG - Intronic
1117992602 14:61449326-61449348 GAGGGGGAGGAAAGGAGGGAGGG - Intronic
1118138057 14:63049514-63049536 GGGGGAGCAGAAAGGAGGAAAGG - Intronic
1118171656 14:63395303-63395325 AAGGGAGGAGAAAGGAGGAGAGG + Intronic
1118310176 14:64686158-64686180 CAGGGGGAGGAGAGGAGGCAGGG - Intergenic
1118444166 14:65836922-65836944 CAGGGTGAAAAAGGGAGAATGGG + Intergenic
1118451585 14:65907243-65907265 GAGGGAGAAGGAAGGAAGAAAGG + Intergenic
1118868988 14:69726122-69726144 CAAGGAGAAGAAAGGCGGGAAGG + Intergenic
1118993157 14:70813766-70813788 AGGGGTGAAGGAAGGAGGGAGGG + Intergenic
1119209999 14:72824397-72824419 CAGGGAGGAGAAGGGGGGAAAGG - Intronic
1119531500 14:75364468-75364490 GAGGGAGGAGATAGGAGGAATGG + Intergenic
1119672732 14:76531772-76531794 CAGGGTGACACAAGGAGGAGAGG - Intergenic
1119674289 14:76542305-76542327 GAGGGGGAAGTAAGGAGGAGGGG - Intergenic
1119787646 14:77325105-77325127 CAGGGTGAGGGTGGGAGGAAGGG + Intronic
1119904798 14:78291980-78292002 CAGGGTGAAGGAAAGAAGAATGG + Intronic
1120033840 14:79673123-79673145 CAGGCTGAAGAGAGGGGAAAGGG + Intronic
1120287125 14:82518104-82518126 AAGGATGAAGAAAGGAAGGAAGG + Intergenic
1121231971 14:92364949-92364971 CAGGGGCAAGGCAGGAGGAAGGG - Intronic
1121497343 14:94402983-94403005 CAGGGGAAAGAAAGGAAGGAAGG - Intergenic
1121627544 14:95397373-95397395 CTGGGTAAAGAAAAGAGAAAGGG - Intergenic
1121752434 14:96368758-96368780 CATGGTGAAGGAAGGAAGGAGGG - Intronic
1121780051 14:96616432-96616454 CAGGGAGAGGCAAGGAGGAGGGG + Intergenic
1121782134 14:96628731-96628753 CCAGGGGAAGAAAGGTGGAAAGG + Intergenic
1121879772 14:97489596-97489618 CGGGGGGAAGTATGGAGGAAAGG - Intergenic
1122070641 14:99203504-99203526 GAGGATGAAGAAAGGAGAAGTGG + Intronic
1122476792 14:102015707-102015729 CAGGGTGAAGGAATGAGGACTGG + Intronic
1122871725 14:104641822-104641844 CAGGGTGAAGGAATGAGTGAAGG + Intergenic
1123697157 15:22887082-22887104 GAGGCTGAAGAAAGCAGGAGTGG - Intronic
1123991265 15:25685323-25685345 AAGGGTGCAGAAAGGAGAAGAGG - Intronic
1124599298 15:31118320-31118342 GAGGGAGAAGAAAGAGGGAAAGG + Intronic
1124810855 15:32936691-32936713 GAAGGAGAAGAAAGAAGGAAAGG + Intronic
1124995615 15:34720545-34720567 GAGAGTGAGGAAAGGAGAAAGGG + Intergenic
1125180196 15:36873765-36873787 GAGGGTAAAGAGAGGTGGAAAGG + Intergenic
1125260392 15:37817749-37817771 AGGGGAGAACAAAGGAGGAAAGG + Intergenic
1125747046 15:42004368-42004390 AAGGGAGAAAAAGGGAGGAAGGG + Intronic
1126170515 15:45691745-45691767 GAGGGGGAAGGAAGGAGGACTGG - Intergenic
1126352017 15:47753723-47753745 CAGGTAAAAGAGAGGAGGAAGGG + Intronic
1126412068 15:48382377-48382399 CAGGTTGAAGAAATGGGGAATGG + Intergenic
1126810522 15:52398569-52398591 AAGGGGGATGAAAGAAGGAAGGG - Intronic
1127480708 15:59374135-59374157 GAGAGAGAAGAAAGGAAGAAAGG + Intronic
1127566393 15:60193383-60193405 TAGAGTGAAGAAAGCAGAAAAGG - Intergenic
1127669150 15:61178017-61178039 AAAGGGGAAGAAATGAGGAAGGG + Intronic
1127828520 15:62727888-62727910 GAGGGTGAAGAGGGGAGGAGTGG + Intronic
1128154626 15:65384914-65384936 AAGGGGCAGGAAAGGAGGAAAGG - Intronic
1128303304 15:66580972-66580994 CAGTGTGAAGAATGGGGGAGAGG - Intergenic
1128510680 15:68312314-68312336 CAGGCAGCAGGAAGGAGGAAGGG - Intronic
1128611006 15:69073678-69073700 CAGGGTGGAGGAAAGTGGAATGG + Intergenic
1128624519 15:69186048-69186070 TAGGGTGAAGTATGGGGGAAGGG + Intronic
1128790802 15:70432141-70432163 CAGGCTGCAGCAAGGAGGCACGG - Intergenic
1128940854 15:71786681-71786703 GAAGATGAGGAAAGGAGGAAAGG + Intergenic
1129471764 15:75759949-75759971 CGGGGTGAAGAAGGGAGGCTTGG - Intergenic
1129519763 15:76178252-76178274 CAGGGTGGAGACAGGAAGACTGG + Intronic
1129933049 15:79428256-79428278 GAGGGAGAAGAAAGGAAGGAGGG - Intergenic
1129975035 15:79815017-79815039 CTGGGAGAAGAGAGGAGGAAGGG - Intergenic
1130732931 15:86517940-86517962 CTAGGTGAAGAAGGCAGGAAGGG - Intronic
1130803352 15:87291268-87291290 TAGGGTGCAGAAAGGAGAACTGG + Intergenic
1130812173 15:87391319-87391341 CTGAGTGAAGCAAGGAGAAAAGG + Intergenic
1131149154 15:90036198-90036220 GGAGGGGAAGAAAGGAGGAACGG - Intronic
1131320589 15:91386330-91386352 CAGGCTGCAGTAAGAAGGAAAGG + Intergenic
1131474449 15:92725261-92725283 CAGGGTGAAGAATGTAGCAATGG - Intronic
1131788025 15:95933997-95934019 CAGGGTGCAGAGAGGGGGAGGGG - Intergenic
1132178073 15:99731623-99731645 CAGGGTTAAGAAGGGCGGCAAGG + Intronic
1132184035 15:99788360-99788382 CAGAGGGAGGGAAGGAGGAAAGG - Intergenic
1132243014 15:100275507-100275529 CAGGGTGGAGACAGAAAGAAAGG + Intronic
1132340955 15:101078462-101078484 CAGGGTGCAGAGAGGAAGGAAGG - Intergenic
1132397178 15:101482437-101482459 CAGGGTGAAAGGAGGAGGAGAGG + Intronic
1132446995 15:101932719-101932741 CAGGTTGAAGAAATAAGAAAGGG - Intergenic
1132612012 16:821933-821955 GAGGGTCAAGAAGGGAGGAAAGG - Intergenic
1132733443 16:1374428-1374450 CCAGGTGAGGACAGGAGGAAGGG - Intronic
1133392672 16:5422509-5422531 GGAGGTGAGGAAAGGAGGAAGGG + Intergenic
1133479853 16:6159601-6159623 CAGAGTGAAAAAAGCAGGAGGGG - Intronic
1133666173 16:7970370-7970392 CAGAGGGAAGAAAGGAGGGAGGG - Intergenic
1134000812 16:10781367-10781389 CACAGTGATGAAAGGGGGAAAGG + Intronic
1134010770 16:10851002-10851024 CAGGGAGAAGAAACGAGGAAAGG + Intergenic
1134019452 16:10911322-10911344 AAGGGGGAAGAAGGGAGGGAGGG - Intronic
1134392589 16:13833181-13833203 CAGGAGGCAGAAGGGAGGAAAGG - Intergenic
1134449315 16:14354002-14354024 GAGGGGGAGGGAAGGAGGAAGGG + Intergenic
1134597970 16:15511032-15511054 CAGGCTTGAGAAAGGAGGGAAGG - Intronic
1134598631 16:15515680-15515702 CACGGGGAAGAAAGAGGGAAGGG + Intronic
1134792169 16:16998862-16998884 CTGGGTGAAGAAGGAAGGGATGG + Intergenic
1134853800 16:17503122-17503144 AAGGGAGAGGAAAGGAGGCAAGG + Intergenic
1135547843 16:23377706-23377728 GAGGGAGAAGGAAGGAGGAAAGG - Intronic
1135627170 16:24006067-24006089 GAGAGGGAAGAAGGGAGGAAGGG - Intronic
1135732513 16:24906842-24906864 CAGGGTCAAGAAAGGAGGGCTGG + Intronic
1135920389 16:26644086-26644108 AAGGGAGAAGGAGGGAGGAAGGG - Intergenic
1135931471 16:26741437-26741459 GAGGATGAAGAGAGGAGGTAAGG - Intergenic
1135974542 16:27099317-27099339 CCAGGTGAAGGAAGTAGGAATGG + Intergenic
1136014677 16:27388463-27388485 TAGGCAGGAGAAAGGAGGAAGGG + Intergenic
1136684956 16:31988638-31988660 CAGCGTGAGGAGAGGTGGAAGGG + Intergenic
1136884201 16:33921631-33921653 CAGCGTGAGGAGAGGTGGAAGGG - Intergenic
1137826959 16:51506397-51506419 CAGTGTGAAGAAAGGATGGAAGG - Intergenic
1138235877 16:55382213-55382235 GAGGGTGAAGAAAGGCCAAAGGG - Intergenic
1138644234 16:58411611-58411633 AAGGGAGAGGAAGGGAGGAAGGG + Intergenic
1139121027 16:64017253-64017275 AAGGATGGAGAAAGGAGGTAGGG + Intergenic
1139162261 16:64524961-64524983 GAGGGTGAAGAGAGGATGAGGGG + Intergenic
1139188756 16:64837596-64837618 AAGGAAGAAGAAAGAAGGAAGGG - Intergenic
1139330751 16:66188019-66188041 CAGGTAGAATAAAGCAGGAATGG - Intergenic
1140018688 16:71215269-71215291 GAGGGGGAAGGAAGGAGGGAGGG + Intronic
1140153766 16:72401117-72401139 CTGGGGGAAGAGAGGAGGAGTGG + Intergenic
1140257544 16:73349852-73349874 GAGGGGGAAGAAAGGAAGAGAGG - Intergenic
1140273266 16:73485054-73485076 AAGGGTAAAGAAAGAAGTAATGG + Intergenic
1140486829 16:75300103-75300125 CTGGGTGGAGAATGGATGAAAGG + Intronic
1140541489 16:75760293-75760315 AAGGGAAAAGAAAGGAAGAATGG - Intronic
1140854714 16:78967921-78967943 GGGGGTGAGGAAAGGAAGAAAGG - Intronic
1140950771 16:79815333-79815355 CTGGGTGAAGAAAAATGGAAAGG + Intergenic
1141012465 16:80415722-80415744 GAGGGTGCAGAGAGGAGGCATGG - Intergenic
1141878373 16:86841880-86841902 CAGGGAGGAGAATGGAGGCAGGG - Intergenic
1143276300 17:5713605-5713627 CAGTGTGGAGAAGGAAGGAAAGG + Intergenic
1143278344 17:5731283-5731305 CAGGGGGAAGGAGGGAGGAGGGG - Intergenic
1143373781 17:6455692-6455714 CAGGGGGAAGAAGGGAGGGGAGG + Intronic
1143411169 17:6710000-6710022 CAGGGTGAGGGCAGGAGAAAGGG + Intronic
1143628148 17:8122491-8122513 CAGGGGGAAGAAGGGAGGGACGG + Intronic
1143913051 17:10267764-10267786 CAAGGAGAAGACAGGAGGCAAGG - Intergenic
1143916226 17:10295281-10295303 CACGTTGGAGAAAGGTGGAAAGG + Intergenic
1144058585 17:11561732-11561754 CAGGGAAAAGAAATTAGGAATGG - Exonic
1144105989 17:11985893-11985915 CAGGGAATAGAAATGAGGAAAGG + Intronic
1144244068 17:13345871-13345893 CAGGGTGAAGAGAAGGGGAATGG + Intergenic
1144388765 17:14774161-14774183 CAGGGTGAAGCAAAGAGAAATGG - Intergenic
1144437576 17:15255383-15255405 TAGGGTGGAGAAAGGAGGTGGGG - Intronic
1144872975 17:18381946-18381968 CAGGGTGAAGTAGTGAGGAGAGG + Intronic
1145058744 17:19719348-19719370 CAGATGGAAGAAGGGAGGAAGGG + Intergenic
1145799779 17:27675645-27675667 CTGGGGGAAGAATGGATGAATGG - Intergenic
1146535438 17:33646837-33646859 CAGAGTAAAGTAGGGAGGAAGGG + Intronic
1146537315 17:33663990-33664012 CAGGATGAAGACAGGCTGAAAGG - Intronic
1146630011 17:34463095-34463117 CTGGTTGAAGAGAGGAGAAAAGG + Intergenic
1146642782 17:34553722-34553744 CGGGGTGAAGGAAGGATGAGGGG + Intergenic
1146762581 17:35491319-35491341 CTGGAGGAAGAAAGTAGGAAGGG - Intronic
1146890229 17:36502002-36502024 GAGGGAGAAGAAAGGAGAAAGGG + Intronic
1146940055 17:36838174-36838196 AAGGGGCAAGAAAGGAAGAAGGG - Intergenic
1147145898 17:38484319-38484341 CAGCGTGAGGAGAGGCGGAAGGG + Intronic
1147363358 17:39944850-39944872 TAGGGGGAATAAAGGAGGGAGGG - Intergenic
1147741975 17:42675105-42675127 CAGGGGGAAGGGAGGAGGAGGGG - Intronic
1148713638 17:49700009-49700031 GAGGGTGGAGAAAGGAAGGAAGG + Intergenic
1148751806 17:49949476-49949498 GGGGGTGGAGAAGGGAGGAAGGG + Intergenic
1149133109 17:53331703-53331725 GAGGGTGAAGAAATGAGCTAAGG - Intergenic
1149716684 17:58797401-58797423 TATGGTGAAAAAAGGAGTAATGG - Intronic
1149888391 17:60363856-60363878 TTGGGAGAAGGAAGGAGGAAGGG + Intronic
1150198615 17:63328630-63328652 GAGTGTGAAGAAGGAAGGAATGG + Intronic
1150219373 17:63487424-63487446 CAGGGTCACGAAAGGAGGCCGGG - Intronic
1150356538 17:64490908-64490930 CAGGATGAAGAAGGCCGGAAAGG - Exonic
1150374975 17:64673595-64673617 AAAGGAAAAGAAAGGAGGAAGGG + Intergenic
1150381372 17:64722990-64723012 CAGAGGGAAGGAAGGAAGAAAGG + Intergenic
1150386139 17:64762371-64762393 TGGGATGAAGAAAGGATGAAGGG + Intergenic
1150487438 17:65553709-65553731 CAGGGCAGAGAAAGGAGGCAGGG + Intronic
1150628345 17:66858293-66858315 CCGGGTCCAGAAAGGAGGCAAGG - Intronic
1150645763 17:66976581-66976603 TGGGGAGGAGAAAGGAGGAATGG - Intronic
1150646460 17:66981006-66981028 CATGGTGAATACTGGAGGAAAGG + Intronic
1150648521 17:66994861-66994883 CAGGGTGGTGAAGGGGGGAATGG + Intronic
1150753938 17:67893687-67893709 TGGGATGAAGAAAGGATGAAGGG - Exonic
1151078473 17:71301374-71301396 GAAAGAGAAGAAAGGAGGAAAGG - Intergenic
1151325396 17:73376855-73376877 GAGGAGGAAGGAAGGAGGAAAGG - Intronic
1151748270 17:76023054-76023076 CAGGGTGAAGTAGTGAGGAGAGG - Intronic
1152609313 17:81307818-81307840 CAGGAAGGAGAAAGGAGGGAAGG - Intergenic
1153180947 18:2432315-2432337 CAGGGTGGAGAATGGTGGGAAGG + Intergenic
1153527561 18:6012216-6012238 CAAGATGAAGAATGGAGGAAAGG + Intronic
1153764332 18:8361154-8361176 AGGGGTGAAGGAAGGAAGAAAGG - Intronic
1154082476 18:11271964-11271986 CAGGTTGACGTAAGTAGGAAGGG - Intergenic
1155118447 18:22793760-22793782 CTGGGAGGAGGAAGGAGGAAAGG + Intergenic
1155135453 18:22987234-22987256 AAGGGGGAGGGAAGGAGGAAGGG + Intronic
1155231665 18:23780315-23780337 CAGGGTGAAGGAAAGAAGGAAGG + Intronic
1155504080 18:26516038-26516060 CAGGGTCAGGGAAGCAGGAAAGG + Intronic
1155824492 18:30422308-30422330 AAAGAAGAAGAAAGGAGGAAGGG + Intergenic
1156136068 18:34039614-34039636 CAGGCTAAAGAAAAGTGGAATGG - Intronic
1156187382 18:34678622-34678644 CAGGGAGAAGCAAGGAAGAAAGG + Intronic
1156340396 18:36205396-36205418 GAGGGTGAATGAAGGTGGAAAGG - Intronic
1156358211 18:36361028-36361050 GAGGGTGCAGAAGGGAAGAAAGG + Intronic
1156361651 18:36389250-36389272 AAGGGAGAAGAAAGGAAAAAAGG - Intronic
1156630532 18:38962993-38963015 GAAGGTGTAGAAAGGAAGAAAGG - Intergenic
1156749965 18:40440362-40440384 AAGAGTGGAGAAATGAGGAAAGG + Intergenic
1156859025 18:41815080-41815102 AAGAGGGAAGAAGGGAGGAAGGG + Intergenic
1157007467 18:43601637-43601659 CAGAGGGAAGAAGGAAGGAACGG + Intergenic
1157294905 18:46435414-46435436 CTGGGGGAGGAAGGGAGGAAGGG + Intronic
1157347308 18:46851334-46851356 AAGGTTGAAGAAAGGAAGAAGGG - Intronic
1157499139 18:48177842-48177864 CTAGGTGGAGAATGGAGGAAGGG + Intronic
1157808824 18:50678792-50678814 CTGGGTGAAGGCAGCAGGAAAGG + Intronic
1157994463 18:52538578-52538600 CAGTCTGGAGCAAGGAGGAATGG - Intronic
1158066010 18:53409122-53409144 TGGAGTGAAGAAAGGTGGAATGG + Intronic
1158423093 18:57313403-57313425 CATGGGGAAGGAAGGAGGAAAGG + Intergenic
1158664114 18:59416909-59416931 CAGCCAGCAGAAAGGAGGAAGGG + Intergenic
1159020114 18:63136361-63136383 CAGGTTGAAGACAGGAAGAGAGG - Intronic
1159355995 18:67338021-67338043 GAGGGTAAAGAAAGAAAGAAAGG - Intergenic
1159752843 18:72324394-72324416 GAGGAAGAAGAAAGGAAGAAAGG - Intergenic
1159897207 18:74008608-74008630 AAGGGTGAGGAAGGGAGGCATGG - Intergenic
1160356130 18:78229634-78229656 AGGGAGGAAGAAAGGAGGAAGGG - Intergenic
1160638281 19:99814-99836 CAGGTTGAAGAAATAAGAAAGGG + Intergenic
1160814842 19:1030236-1030258 CCGGGTGCAGAAAGGTGGCAGGG + Intronic
1160872131 19:1282370-1282392 AAGGGGGAAGGAAGGAGGGAGGG + Intergenic
1160914721 19:1491092-1491114 CAGGGCGGACAAAGGAGGAGGGG - Exonic
1160985265 19:1835761-1835783 TGGGGTGAAGCAGGGAGGAAGGG - Intronic
1161139620 19:2639768-2639790 AAGGGGGAAGAAGGGAGGGAAGG + Intronic
1161415668 19:4145254-4145276 GAGGGAGAAGAGAGGAGGAGGGG + Intergenic
1161520343 19:4720293-4720315 AAGGGTGAAGCAAGTAGGCAAGG - Intronic
1161821537 19:6533546-6533568 GAGGGGGAAGGAAGGGGGAAGGG - Intronic
1161821643 19:6533801-6533823 CAGGGGGAGGGAAGGGGGAAGGG - Intronic
1161899799 19:7109924-7109946 CTGGGAGCAGAAAGGAGGAGGGG + Intergenic
1162063293 19:8109802-8109824 CAGGATGAAGCTAGGAGGGAGGG - Intronic
1162415865 19:10536836-10536858 AAGGAGGAAGACAGGAGGAAGGG + Intergenic
1162791783 19:13066791-13066813 CAGGGTGAGGAATGGAGAGAAGG + Intronic
1163207208 19:15812480-15812502 CAGGAGGAAGGAAGGAGGGAGGG + Intergenic
1163230545 19:15998771-15998793 GAGGGTGAAGCAAGAAGGAAGGG + Intergenic
1163469016 19:17486262-17486284 CAGGGGACAGAAAGGAGGATGGG + Intronic
1164005326 19:21143038-21143060 GAGGCTGGAGAAATGAGGAATGG - Intronic
1164101038 19:22054425-22054447 TAGGCTGAAGAAATGATGAAGGG - Intronic
1164159186 19:22615668-22615690 CAGGGTGAAGGAAAAAGAAAAGG + Intergenic
1164292209 19:23878991-23879013 AAGGAAGAAGAGAGGAGGAATGG + Intergenic
1164292574 19:23881141-23881163 AAGGAGGAAGAGAGGAGGAAAGG + Intergenic
1164393743 19:27846423-27846445 CCGGGGGAAGAATGGAGGGAAGG + Intergenic
1164447689 19:28331813-28331835 CAGAGTGAAAAATGGAGGCAAGG + Intergenic
1164520115 19:28972743-28972765 CAGGATGGAGAAGAGAGGAAAGG + Intergenic
1164587838 19:29487942-29487964 CAGAAGGAAGAAAAGAGGAAAGG + Intergenic
1164714994 19:30384679-30384701 GAGGGTTGAGAGAGGAGGAATGG + Intronic
1165358489 19:35318941-35318963 GAGGTTGAAGAAAGCAGGAGGGG + Intergenic
1165406552 19:35634268-35634290 CTGGGTGAAGACAAGAAGAAGGG + Exonic
1165637571 19:37355097-37355119 AAAGGGGAAGGAAGGAGGAAGGG - Intronic
1166054018 19:40277968-40277990 CAGGGGGAAGAGATGAGGATGGG - Intronic
1166277244 19:41762509-41762531 CACAGAGAAAAAAGGAGGAAGGG + Intronic
1166881110 19:45930685-45930707 AAGGGGGAAGGAGGGAGGAAGGG - Intergenic
1166929905 19:46296425-46296447 GAGGGTGCAGACTGGAGGAATGG + Intergenic
1166939552 19:46354488-46354510 CACTTTGAAGAAAAGAGGAAGGG + Intronic
1167130220 19:47580499-47580521 TAGGGTGAAAAAAGAAGGAAAGG + Intergenic
1167226813 19:48249771-48249793 CAGGGTGCAGGAAGGAGGAGCGG + Intronic
1167254407 19:48418656-48418678 GAGGGAGAAGGAGGGAGGAAGGG + Intronic
1167854567 19:52227245-52227267 CAGAGTGCAGGAAGGAGGAAAGG - Exonic
1168321759 19:55514619-55514641 GAGAGAGAAGAAGGGAGGAAGGG + Intronic
925223358 2:2160824-2160846 CAGGGAGGAGAAGGAAGGAAAGG + Intronic
925299432 2:2800138-2800160 AAGGGGGAAGGAAGGAGGAAGGG + Intergenic
925402083 2:3582040-3582062 CAGGGTGAAGACAGCGGAAATGG - Intergenic
925476978 2:4228003-4228025 CAGGGTGAAGGAAAGAGAAAGGG + Intergenic
925509432 2:4608918-4608940 CAAGGTGAAGCATGGGGGAAGGG + Intergenic
925842614 2:8006714-8006736 CAGGGGGCAGAGAGGAGGCAGGG - Intergenic
925896085 2:8473325-8473347 CTGGCTGAGGTAAGGAGGAAGGG + Intergenic
926045934 2:9709674-9709696 CTGGGTGAAGGAAAGAGGGAAGG - Intergenic
926087517 2:10029383-10029405 CTGGGTGGAGACAGGTGGAAAGG - Intergenic
926266809 2:11330795-11330817 GAGGGAGGAGAGAGGAGGAAGGG + Intronic
926490916 2:13525589-13525611 CAGGGTGAAAGAAAAAGGAAGGG + Intergenic
926578091 2:14604840-14604862 CAGGAAGAAGAAAGGAAGACAGG - Intergenic
926700245 2:15798665-15798687 AAAAGAGAAGAAAGGAGGAAGGG + Intergenic
927070567 2:19524555-19524577 CAGGGTGACAAAAGAAGCAATGG - Intergenic
927164015 2:20298983-20299005 TAGGGTGAGGCATGGAGGAAGGG - Intronic
927686922 2:25177655-25177677 CAGAGTCAAGAGTGGAGGAAGGG + Intergenic
927927422 2:27023688-27023710 CAGGGTCCAGAGAGGAGGAAGGG - Intronic
927945148 2:27131141-27131163 TAGGCAGAAGAAAGGAGGCAGGG + Exonic
928444322 2:31319461-31319483 CAGGATGAAGAAACTAGGAAAGG + Intergenic
928542565 2:32297047-32297069 CTGTGTGAAGTAAGAAGGAAAGG - Intronic
928682248 2:33714467-33714489 GAAGGAAAAGAAAGGAGGAAGGG + Intergenic
928921893 2:36535151-36535173 GAGGGGGAAGGAAGGAGGACAGG + Intronic
929046800 2:37798377-37798399 CAGGGAAAAGAAAGATGGAAGGG - Intergenic
929102851 2:38333348-38333370 CAGAGTGAGGGAAGGAGGTAGGG + Intronic
929172796 2:38948521-38948543 AAGGGAGAAGGAAGGAAGAAAGG + Intronic
929380004 2:41338012-41338034 AGGGGGGAAGAAAGGAGGGAGGG + Intergenic
930014677 2:46962209-46962231 CAGAGTGAAGAAAAAAGGCAAGG - Intronic
930156294 2:48111238-48111260 CAGGTTGGGGAAAGAAGGAAAGG + Intergenic
930282292 2:49384854-49384876 ATGGGAGAAGAAATGAGGAAAGG - Intergenic
930832723 2:55762611-55762633 GAGTGAGAAGAAAGGAAGAAAGG - Intergenic
930956026 2:57204168-57204190 CATTGTGAATAAATGAGGAATGG - Intergenic
930969524 2:57377813-57377835 AAGGAAGAAAAAAGGAGGAAAGG + Intergenic
931133833 2:59374038-59374060 CCTGGTGGAGAAATGAGGAATGG - Intergenic
931679877 2:64737279-64737301 TAGGGAGAGGAAGGGAGGAATGG - Intronic
931709871 2:64979422-64979444 CCGGGTGAAGGAAAGAGGGAAGG - Intergenic
932118031 2:69070914-69070936 CAGGGTCAGGGAAGAAGGAAGGG - Intronic
932491756 2:72127232-72127254 GAGGGAGAAGAGAGGGGGAAAGG - Intergenic
933155483 2:78968629-78968651 CAGGGTACAGAACTGAGGAATGG - Intergenic
933553947 2:83808744-83808766 CAGAGGGGAGAAAAGAGGAAAGG - Intergenic
933591516 2:84238161-84238183 CAGTCTACAGAAAGGAGGAAGGG - Intergenic
933669261 2:84991246-84991268 CATGGGGAAGGCAGGAGGAAGGG + Intronic
933748574 2:85588487-85588509 GAGCGTGGAGAAAGGAAGAAGGG - Intronic
933850984 2:86366514-86366536 CAGGGTGGAGGAGGTAGGAAAGG - Intergenic
933971315 2:87472135-87472157 CAGAGGGAATAAAGGAGGGAGGG - Intergenic
935268141 2:101411868-101411890 CAGGGTGAAAGAAAGAGGATGGG + Intronic
935438997 2:103069410-103069432 AAGGTGGAAGGAAGGAGGAAAGG - Intergenic
935465356 2:103389901-103389923 CAGGGTGTGGAATGGAGTAATGG + Intergenic
935501533 2:103846776-103846798 GAGGGAGAAGAAAGGGAGAATGG + Intergenic
935831383 2:107004473-107004495 CAGAGGGAGGACAGGAGGAAGGG - Intergenic
935867918 2:107411231-107411253 CAGGGAGAAGAAAGAATGAATGG - Intergenic
936077047 2:109408231-109408253 CAGAGGGTGGAAAGGAGGAAGGG + Intronic
936322415 2:111478064-111478086 CAGAGGGAATAAAGGAGGGAGGG + Intergenic
936401749 2:112169866-112169888 CACTGAGATGAAAGGAGGAATGG + Intronic
936523956 2:113230268-113230290 CAGGATGAAGGCAGGGGGAAGGG - Intronic
936561059 2:113540450-113540472 GAGGCTGAAGAAAAGAAGAATGG - Intergenic
936806058 2:116333765-116333787 CAGGCAGGAGAAAGAAGGAAAGG - Intergenic
936973967 2:118201408-118201430 CAGGGTTGAGAAAGGAGCAGAGG - Intergenic
937052607 2:118904817-118904839 GAGGGTGGAGTGAGGAGGAATGG + Intergenic
937104282 2:119295358-119295380 CAGGATGGAGGGAGGAGGAAGGG + Intergenic
937113269 2:119384004-119384026 AAGGGAGAAGAAAGGATAAAAGG + Intergenic
937324414 2:120981776-120981798 GAGAGGGAAGAAGGGAGGAAGGG - Intronic
937635829 2:124154345-124154367 CAGAGACAAGAAAGGAAGAAAGG + Intronic
937703565 2:124891948-124891970 CAGGGAGAAGAAAGCAGGGACGG - Intronic
937772909 2:125743037-125743059 TAGGCTGCAGAACGGAGGAAGGG + Intergenic
938602145 2:132853371-132853393 CCAGGTGAAGGAAGCAGGAAAGG - Intronic
938811435 2:134856651-134856673 CTGGGTGAAAAAAGGGGCAAAGG - Intronic
939235159 2:139481880-139481902 CAAGTAGAAGAAAGGAGAAAGGG + Intergenic
939534371 2:143408220-143408242 GAGGAGGAAGAAGGGAGGAAGGG - Intronic
939754247 2:146090056-146090078 CAGGGTGAAGGAAGGGAGAAGGG - Intergenic
939803346 2:146740764-146740786 CATTGTGAAGAAATCAGGAATGG + Intergenic
939875911 2:147577668-147577690 CAGGGCTGAGAAAAGAGGAATGG - Intergenic
940274911 2:151929151-151929173 CAGGGGGAAGCAAGGAGAGATGG + Intronic
940638759 2:156327631-156327653 CAGGATGGAGGAAGGAGGAGAGG - Intronic
940760631 2:157734701-157734723 CGGGGTTAAGAAAGGAGGCTGGG + Intergenic
941273205 2:163456739-163456761 CAGGGAAAAGAAAGGAGAAAAGG + Intergenic
941423436 2:165313227-165313249 CAGGGTAAAGAAGTGAGAAAAGG - Intronic
941569216 2:167148483-167148505 GAGGGAGAGGAAAGAAGGAAGGG + Intronic
941675450 2:168339211-168339233 CAGAGTAAAGGATGGAGGAAGGG + Intergenic
941715264 2:168756722-168756744 CTGGGTGAAGAACGGAGAAAGGG + Intronic
941999718 2:171633823-171633845 GAGGGAGAGGGAAGGAGGAAGGG - Intergenic
942068599 2:172295042-172295064 CAGGTAGCAGAAAGCAGGAAGGG + Intergenic
942255321 2:174091290-174091312 CAGGGAGAACAAGGGAAGAAGGG + Intronic
942479961 2:176374806-176374828 CTGGCTGAAGAAAGGACAAATGG - Intergenic
942593947 2:177574562-177574584 AGTGGTGAACAAAGGAGGAAGGG - Intergenic
942812776 2:180017951-180017973 CAGGGTGAACAAGTGAGAAAGGG + Intergenic
942878161 2:180827449-180827471 CGGGATGGAGAAAGGAGGTAGGG + Intergenic
943053587 2:182946904-182946926 AAGAGGGAGGAAAGGAGGAAGGG + Intronic
943490951 2:188556133-188556155 AAGGGTGAAGAAAGCATAAAAGG - Intronic
943821644 2:192330509-192330531 AAGGGGGAAGAAAGGAGGGAAGG + Intergenic
943883300 2:193176609-193176631 CAGGAGGAAGAAAGGAAAAAAGG - Intergenic
944206009 2:197159125-197159147 CAGGGAGTGGAAAGGAAGAAGGG - Intronic
944993487 2:205266645-205266667 CAGAGTGAAGCAAGGGAGAAAGG - Intronic
945040664 2:205741365-205741387 CCTGGTGAAGAAGGGAGGGAAGG + Intronic
945052143 2:205834269-205834291 CAGGGTGAGGAAAGCATAAAAGG - Intergenic
945098356 2:206240369-206240391 CAGAGTGAAGGAAGGAGCAGAGG - Intergenic
945247226 2:207729663-207729685 AAGGGGAAAGGAAGGAGGAAAGG - Intronic
945401590 2:209388928-209388950 TAGGGTGAAGAGTGGAGGCAGGG + Intergenic
946027260 2:216679380-216679402 CTGGGGGCAGTAAGGAGGAAGGG + Intronic
946060253 2:216935067-216935089 CAGGGTGATGACAGCAGTAAGGG + Intergenic
946066402 2:216991205-216991227 CATGGAGAGGAAAGGAGCAAAGG - Intergenic
946161789 2:217840036-217840058 GAGGAAGAAGAAAGGAGGGAGGG + Intronic
946337250 2:219046180-219046202 AAGGTTGGAGGAAGGAGGAAGGG - Intergenic
946353480 2:219170259-219170281 CAGGCTGTAGAAAGTAGGATAGG + Intronic
946385571 2:219382361-219382383 GAGGGTCACGAGAGGAGGAAGGG - Intronic
946401873 2:219472506-219472528 CTGGGTGAGGAGAGGAGGCACGG + Intronic
946450171 2:219772928-219772950 GGAGGGGAAGAAAGGAGGAAGGG + Intergenic
946625271 2:221605129-221605151 CAGGATGCAGGAAGGAGGAGAGG - Intergenic
946652276 2:221906279-221906301 GAGGGGGAAGAAAGGAGGATTGG + Intergenic
946723296 2:222634559-222634581 GAGGGAGAAGGAGGGAGGAAAGG + Intronic
946896457 2:224329005-224329027 CAGGGTGAGGGGAGTAGGAATGG + Intergenic
946899930 2:224362301-224362323 GAGGAGGAGGAAAGGAGGAAAGG + Intergenic
946946850 2:224830227-224830249 AAGGGGGAAGGAAGGAGGATTGG - Intronic
946998397 2:225422762-225422784 CAAGGAGAATAAAGGAGAAAAGG + Intronic
947006013 2:225512465-225512487 AAGGAGGAAGAAAGGAGGGAGGG - Intronic
947716032 2:232339248-232339270 CAGGCCGCAGAAGGGAGGAACGG + Intronic
948311892 2:236993532-236993554 TAGGGGGAAGGAAGGAGGGAGGG + Intergenic
948458438 2:238118019-238118041 GAGGGTGAATGGAGGAGGAATGG + Intronic
948458446 2:238118048-238118070 GAGGGTGAATGGAGGAGGAATGG + Intronic
948458622 2:238118689-238118711 GAGGGTGGATAGAGGAGGAATGG + Intronic
1168765323 20:378445-378467 AGGGGTGAAGAAAGGTGGGAGGG - Intronic
1169226137 20:3858184-3858206 GGGGGAGAAGAAATGAGGAAGGG - Intronic
1169536003 20:6541179-6541201 CAGGCAGCAGAAAGGAGAAAGGG - Intergenic
1170096801 20:12654545-12654567 CAGGGTGAATGAAAGAGAAAAGG + Intergenic
1170428284 20:16256898-16256920 TAGACTGAAGGAAGGAGGAAAGG + Intergenic
1170646583 20:18201975-18201997 GAAGGAGAAGAAATGAGGAAAGG - Intergenic
1170751740 20:19154368-19154390 CAGGGTGGAGAGAGGAGAAAGGG - Intergenic
1170781539 20:19430058-19430080 GAGAGGGAAGGAAGGAGGAAGGG + Intronic
1170791230 20:19511147-19511169 CAGGGTGGAGAGATGAGGCAGGG - Intronic
1171223728 20:23423168-23423190 CTGGGGGAGGAAAGGAGGCAGGG + Intergenic
1171279397 20:23883342-23883364 CAGGGAGGGGGAAGGAGGAAGGG - Intergenic
1171756380 20:29113721-29113743 GAGAGGGAAGAAAGGAGGGAAGG + Intergenic
1171862371 20:30412817-30412839 GAGAGGGAAGAAAGGAGGGAAGG + Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172599420 20:36173626-36173648 CAGGGCAAAGGGAGGAGGAAGGG - Intronic
1172628625 20:36363486-36363508 CAGGGTGGGGAAAGGAGGACCGG + Intronic
1172887923 20:38244217-38244239 CAGGGAGAAGAAATAAGGATGGG + Intronic
1172939135 20:38642744-38642766 CGGAGTGAAGAAGGGAGGGAGGG - Intronic
1173078108 20:39839999-39840021 CTGGGTGATGGAAGGAAGAAGGG - Intergenic
1173089026 20:39952500-39952522 GAGAGTGAGGAAAGGAGGGAGGG + Intergenic
1173124954 20:40328112-40328134 CAGTGTGAAGAAAGGAAAAAAGG - Intergenic
1173167476 20:40695636-40695658 CAGGTTGAAGAAAGATGGGATGG - Intergenic
1173364127 20:42369690-42369712 CAGCGTGCAGAAAGGAGGATGGG + Intronic
1173541663 20:43857269-43857291 AAGGGGGAAAAAGGGAGGAAGGG + Intergenic
1173647475 20:44642463-44642485 CAGGGAGAAGAAAGAAGGAGAGG + Intronic
1173799782 20:45887635-45887657 AAGGGTGAAGAAGGGAGGACAGG - Exonic
1173846499 20:46191930-46191952 CAGAGTGAAAGAAGGAGGGAGGG - Intronic
1174002394 20:47384351-47384373 CAGGGTGCTGAAAGGAGGTGGGG + Intergenic
1174054624 20:47789219-47789241 CAGAGGGAAGAAACGAGGCATGG - Intergenic
1174105371 20:48158294-48158316 GAGGGAGAAGGAAGGAGGAAAGG - Intergenic
1174794392 20:53510256-53510278 CAGGATGAATAATGGAGGACAGG + Intergenic
1174939779 20:54913458-54913480 CAGACAGAAGAAAGGATGAAAGG + Intergenic
1175040670 20:56047310-56047332 CACAGTGAAGAAAGTATGAATGG + Intergenic
1175052480 20:56168104-56168126 CAGAGAGAGGGAAGGAGGAAGGG - Intergenic
1175107599 20:56626305-56626327 CAGGATCAAGCAAGGTGGAAAGG - Intergenic
1175319921 20:58078417-58078439 CAGGGGGAAGAAGAGAAGAAAGG + Intergenic
1175329331 20:58152255-58152277 TATGGTGAAGAAGAGAGGAAGGG - Intronic
1175531978 20:59680080-59680102 CAGGAAGAAGGAAGGAGGGAGGG - Intronic
1175625259 20:60484134-60484156 AGGGGCGAAGAAAGGAGGACAGG + Intergenic
1176857655 21:13985163-13985185 CAGGGTCAGGACAGGAGGCAGGG - Intergenic
1177260020 21:18717721-18717743 CAGGATGAAGAAAGCAAAAAAGG - Intergenic
1177848700 21:26321399-26321421 TAAGGGGAAGAAAGGAAGAAAGG + Intergenic
1178043962 21:28673201-28673223 CAGAAAGAAGAAAGGATGAAAGG + Intergenic
1178157081 21:29867396-29867418 AGGGCTGAAGAGAGGAGGAAGGG + Intronic
1178157194 21:29868618-29868640 AGGGCTGAAGAGAGGAGGAAGGG - Intronic
1178259586 21:31086454-31086476 AAGGGAAAGGAAAGGAGGAAAGG + Intergenic
1178306138 21:31491544-31491566 GAGTGTGAAGAAAGGAGGGTTGG - Intronic
1178327412 21:31657185-31657207 AGGGGTGGGGAAAGGAGGAAAGG - Intergenic
1178403050 21:32303604-32303626 CAGGGAGGAGAAGGGAGGATAGG + Intronic
1178407591 21:32337254-32337276 CAGGGTGAAGATATGAGGACCGG - Intronic
1178637055 21:34313287-34313309 CAGAGGGAAGGAAGGAAGAAAGG + Intergenic
1178780908 21:35602928-35602950 CAGGCTGCAGGAAGGAGGAGAGG + Intronic
1178873805 21:36397072-36397094 CAGGATGAAGAGGGGATGAAGGG - Intronic
1179239603 21:39578343-39578365 CACACTGAACAAAGGAGGAAAGG + Intronic
1179365236 21:40752827-40752849 AAGAGGGAAGCAAGGAGGAAAGG + Intronic
1179474420 21:41634219-41634241 CCGGGAGAAGGAAGGAGGAGGGG - Intergenic
1179484336 21:41700106-41700128 GAGAGGGAAGAAAGGAGGGAGGG + Intergenic
1179599316 21:42465543-42465565 AAGGGTGCAGAAAGAAAGAAAGG - Intergenic
1180187839 21:46148764-46148786 CAGTTGGAAGAAAGGAGAAAAGG + Intronic
1180413434 22:12637578-12637600 GAGAGGGAAGAAAGGAGGGAAGG + Intergenic
1180630256 22:17224337-17224359 AAGGTTGAAGAAAGCAAGAAAGG + Intergenic
1181058598 22:20271339-20271361 CGAGGTGAACAAAGGAGGGATGG - Intronic
1181306724 22:21921325-21921347 CAGGGGGAGGAGAGGAGAAAGGG - Exonic
1181380390 22:22497656-22497678 CAGGGTGAAGTTAAGGGGAATGG + Intronic
1181389898 22:22572669-22572691 CAGAGGGAAGTAAGGAAGAAGGG + Intergenic
1181518728 22:23433353-23433375 CAGGGAGAGGAAAGGCGGCAAGG - Intergenic
1181759962 22:25051540-25051562 AAGGATCAGGAAAGGAGGAAGGG - Intronic
1181933340 22:26420869-26420891 GAGGAGGAAGGAAGGAGGAAAGG - Intergenic
1182098787 22:27643475-27643497 GAGAGAAAAGAAAGGAGGAAAGG + Intergenic
1183043151 22:35198381-35198403 CAGGGTGAAGAAGGGGGAGAGGG - Intergenic
1183162817 22:36126427-36126449 GAGGGAGAGGAAGGGAGGAAAGG - Intergenic
1183162824 22:36126449-36126471 GAGGGAGAGGAAGGGAGGAAAGG - Intergenic
1183162871 22:36126647-36126669 GAGGGAGAGGAAGGGAGGAAAGG - Intergenic
1183246232 22:36695596-36695618 CCAGGTGAAGAGAGGAAGAAAGG - Intronic
1183466809 22:37984198-37984220 CAGGCTGAGGGAAGAAGGAAAGG - Intronic
1183543666 22:38444195-38444217 CGGGGTGAAGTAGGGAGGCAAGG - Intronic
1183705190 22:39471531-39471553 GAGGGCGAAGGAAGGAGGAACGG - Intronic
1183733991 22:39633566-39633588 CAGGCAGAAGAGAGGAGCAAGGG + Intronic
1183951429 22:41355122-41355144 CTGGATGAAGAGTGGAGGAAGGG + Intronic
1184306487 22:43606416-43606438 CTGGGTGAACAAATGAAGAAAGG + Intronic
1184672553 22:46023028-46023050 GGAGGAGAAGAAAGGAGGAAGGG + Intergenic
1184912701 22:47547076-47547098 CCGGGTGAAGGAGGGAGGTAGGG - Intergenic
1184982738 22:48105769-48105791 CAGTCTGATGAAAGGAGGGAGGG - Intergenic
1185413975 22:50699820-50699842 CAAGGCCAAGGAAGGAGGAAAGG - Intergenic
949379988 3:3433641-3433663 GAGGGAGAAGAAAGGAGGGATGG + Intergenic
949960015 3:9304295-9304317 CTGGGGAAAGAAAGGAGGGAGGG - Intronic
949961296 3:9314652-9314674 CAGGGTGGAGAGAGGAGGGCAGG - Intronic
950103846 3:10375981-10376003 CTGTGTGAATAAAGGAGGAATGG + Intronic
950126321 3:10511925-10511947 AGAGGTGAAGAAAGGAGGAAAGG + Intronic
950478882 3:13232497-13232519 CAGGGAGAAGAAAGGCGGGGAGG + Intergenic
951474947 3:23094912-23094934 CATGGAGAAGGAAGGAGGCAAGG + Intergenic
951708664 3:25568498-25568520 AAGGGGGAAGAAAGGAAAAAAGG - Intronic
951894085 3:27594586-27594608 AAGGGAAAAGAAAGCAGGAAAGG + Intergenic
951927763 3:27927312-27927334 CAGATTGGAGAAAGGAGGATGGG - Intergenic
952514627 3:34091411-34091433 ATGGTGGAAGAAAGGAGGAATGG - Intergenic
952534668 3:34296959-34296981 CAGGGTGCCAAGAGGAGGAATGG - Intergenic
952606836 3:35157915-35157937 CAGGGGGAAGAACCGAAGAAGGG - Intergenic
953285458 3:41602325-41602347 AAGGGAAAGGAAAGGAGGAAGGG + Intronic
953495838 3:43386367-43386389 AAAGAGGAAGAAAGGAGGAAAGG + Intronic
953515317 3:43585338-43585360 AAGGGAGAAGAGAGGAAGAAAGG + Intronic
953564645 3:44021416-44021438 AAGGAGGGAGAAAGGAGGAAGGG - Intergenic
953701144 3:45196736-45196758 GAGACAGAAGAAAGGAGGAATGG + Intergenic
953901724 3:46847328-46847350 TAGGGTGAAGGGAGGAGGATGGG - Intergenic
954575851 3:51675835-51675857 TTGGGTGGAGAAAGGTGGAAGGG + Intronic
954603498 3:51891219-51891241 AAGGATGGAGAATGGAGGAAAGG - Intergenic
954644728 3:52124208-52124230 CCTGATGAGGAAAGGAGGAAAGG - Intronic
954670971 3:52291205-52291227 CAGGGTAAAGTTAGGAGCAAGGG + Intronic
955043107 3:55335833-55335855 CAGGGAGCAGAAAGTAGAAATGG + Intergenic
955107049 3:55908472-55908494 GAGAGTGAACAGAGGAGGAAAGG + Intronic
955504515 3:59617963-59617985 CAGGCAGAAGAAAGAAAGAAAGG + Intergenic
955546850 3:60040442-60040464 GAAGGTCAAGAAAGAAGGAAAGG - Intronic
955617666 3:60826111-60826133 GCGAGTAAAGAAAGGAGGAAAGG + Intronic
955979815 3:64513507-64513529 CAGGGTGACAAAAAGATGAATGG - Intergenic
956426901 3:69145194-69145216 CAGGCAGAAAAAAGGAGGAGGGG + Intergenic
956570438 3:70688668-70688690 CAGGGAGAAGAAAGAAATAAAGG - Intergenic
957041040 3:75335809-75335831 GAGTATGAAGGAAGGAGGAATGG - Intergenic
957132105 3:76235913-76235935 TAGGATGAAGAAAGCAGGGAAGG + Intronic
957236406 3:77598001-77598023 CTGGATGAAGAATGGAGTAACGG + Intronic
957521436 3:81323549-81323571 AAAAGGGAAGAAAGGAGGAAAGG + Intergenic
958891622 3:99790230-99790252 CAGCCAGAAGGAAGGAGGAAGGG + Intronic
958982609 3:100740745-100740767 CAGGATGAAGCAAAGAGTAATGG - Intronic
959357810 3:105354354-105354376 AAGGGAGAAGAACGGAGGAGAGG - Intergenic
959469639 3:106734415-106734437 GAGGAGGAAGAAAGGAAGAATGG - Intergenic
959668647 3:108949337-108949359 CCAGGTGAAGAAGAGAGGAAGGG + Intronic
959939781 3:112068807-112068829 CAGGCAGAAGAAAGAAGTAAAGG - Intronic
960287420 3:115845217-115845239 CAGTGAGAAGAAATGAGGACTGG - Intronic
960391381 3:117081464-117081486 GAGGGTGGAGGAAGGAGAAATGG - Intronic
960418599 3:117415591-117415613 AAGGGGGAGGAAGGGAGGAAGGG - Intergenic
960630942 3:119729747-119729769 CAAGTTGAAGGTAGGAGGAAAGG + Intronic
960671730 3:120160960-120160982 CAGGGTGAGGCCAGAAGGAAAGG - Intergenic
961045848 3:123707464-123707486 GAGTATGAAGGAAGGAGGAATGG - Intronic
961061307 3:123831493-123831515 CAGGGTGGACTGAGGAGGAATGG + Intronic
961158539 3:124701630-124701652 CAAGGTCAAGAAAGGAGAAAAGG - Intronic
962625684 3:137223702-137223724 CAAGATGAAGAAAGAAAGAATGG + Intergenic
962715647 3:138124000-138124022 TAGGATGAAGAAAAGAGGAAAGG - Exonic
962875199 3:139530774-139530796 CAGAGGGAAGAAAGAGGGAAGGG + Intronic
962992240 3:140588826-140588848 CAGGTAGAAATAAGGAGGAAGGG - Intergenic
963101384 3:141608939-141608961 AAGGGATAAGAAGGGAGGAATGG + Intronic
963121840 3:141783092-141783114 CAGGTAGGAGAAAGGAGGAAGGG + Intronic
965272265 3:166633326-166633348 CAAGAGGAAGAAATGAGGAAAGG + Intergenic
965505117 3:169506878-169506900 GAGGGAGAAGAAAAGAGGCATGG - Intronic
965673788 3:171173910-171173932 CAGGGAGAAGAGAGGAAGCAGGG + Intronic
965729583 3:171756548-171756570 CGGGGGGAAGAAAGGATGGAAGG + Intronic
966044802 3:175534877-175534899 CAGTGTGAACAAAGAAAGAAAGG - Intronic
966340456 3:178920099-178920121 GAGGATGAGGAAAGGAGGAAAGG - Intergenic
966451046 3:180062315-180062337 CAGGCTGAAGAAGAAAGGAAGGG - Intergenic
966598026 3:181744995-181745017 CAGAAGGAAGGAAGGAGGAAGGG - Intergenic
966746150 3:183279516-183279538 CAGGGTGAAGGAAGGGAAAAAGG - Intronic
967214911 3:187201559-187201581 CAGGGGGCAGAAGGGAGAAAAGG - Intergenic
967442831 3:189528620-189528642 CAGAGAGGAGAAAGGAGGAATGG - Intergenic
967490919 3:190089912-190089934 CAGGGTGAAGAAATGATGAATGG + Intronic
967514670 3:190352902-190352924 AAGGGTGGAAAAATGAGGAAAGG - Intronic
967665843 3:192170971-192170993 AAGGGTGAGTAAATGAGGAATGG - Intronic
967749101 3:193093630-193093652 CATGAGGAAGAAAGTAGGAAAGG - Intergenic
968695060 4:2020357-2020379 AAGAGGGAAGAAAGGAAGAAAGG - Intronic
968710822 4:2116006-2116028 CAAGGTGCAGAAAGCTGGAATGG - Intronic
969525292 4:7701169-7701191 CAGGAAGGAGAAAGGAGGAAGGG + Intronic
969696354 4:8737320-8737342 CAGGGTGCAGGAGGCAGGAAGGG + Intergenic
969721481 4:8894930-8894952 CAGGGTGCACAAGGGAAGAACGG - Intergenic
970148150 4:13058769-13058791 AAGGGTGAAGGAAGGCAGAAAGG - Intergenic
970193081 4:13533464-13533486 GAGGGGGAGGAAAGGAGGTAAGG - Intergenic
970224576 4:13844178-13844200 GAGAGAGAAGAAAGGAAGAAAGG - Intergenic
970442126 4:16090343-16090365 GAGGGAGAAGAAAGGAGAAGAGG + Intergenic
970487491 4:16539247-16539269 CTGGGTAAAGAGAGGAGAAAAGG + Intronic
970562982 4:17300937-17300959 TAGGGAAAATAAAGGAGGAAAGG + Intergenic
970640154 4:18055417-18055439 AAGAGTGAGGGAAGGAGGAAAGG - Intergenic
970850693 4:20598950-20598972 CTGGGTAAAGAAAGTTGGAAGGG + Intronic
970980957 4:22096344-22096366 CGGGGTGATGAAAGGATAAAAGG + Intergenic
971147599 4:23995770-23995792 CAGGATGAGGAAGGAAGGAAAGG - Intergenic
971367075 4:25985950-25985972 CAGTGTGAAGAATGGATGAGGGG - Intergenic
971450170 4:26792858-26792880 CAGGGTAGAGGAAGGAGGACAGG - Intergenic
971471638 4:27032704-27032726 GATAGTGAAGAAAGGAAGAAAGG - Intergenic
972335285 4:38102463-38102485 AAGTGAGAAGAAGGGAGGAAGGG + Intronic
972698164 4:41468250-41468272 CAGAAGGAAGAAAGGAGGGAGGG - Intronic
973147049 4:46840183-46840205 CAGGAATGAGAAAGGAGGAAGGG + Intronic
973171337 4:47147731-47147753 AAGGGGAAAGACAGGAGGAATGG + Intronic
973184300 4:47306418-47306440 CAGGGTAGAGATAGGAGGAAGGG + Intronic
973977141 4:56273375-56273397 GAGAGGGAAGAAAGGAGGGAGGG - Intronic
974464748 4:62240738-62240760 CAAAGAGAAGAAATGAGGAAAGG + Intergenic
974753241 4:66169618-66169640 AAAGGAGAAGAAAGGAAGAAGGG - Intergenic
975245583 4:72117080-72117102 CAGGGTGAAGGAAAAAGAAAAGG - Intronic
975394097 4:73854880-73854902 CAGGTTGAAGACTGGAGAAAGGG - Intergenic
975999260 4:80353342-80353364 AGGGGTGAAGAAAGCAGGATTGG - Intronic
976355361 4:84110880-84110902 AAGGGAGGAAAAAGGAGGAAGGG - Intergenic
976412773 4:84735557-84735579 AAGGGAGAAGAAAGCAGGATTGG - Intronic
977076418 4:92456767-92456789 CAGGAAGAAGTAAGGAGAAATGG - Intronic
977186199 4:93940400-93940422 GAGGGTGAAGGAAGGTGGGATGG - Intergenic
977379953 4:96260088-96260110 CTGGGTGAAGTGAGGAGGATGGG + Intergenic
977655445 4:99516048-99516070 AAGGGTGGAGAAAGGTGCAAAGG - Intronic
977965448 4:103142053-103142075 GAGTGTGAAGAGAGGAGGACAGG - Intronic
978212123 4:106149519-106149541 GAGGGAGAAAAATGGAGGAATGG + Intronic
978250579 4:106627070-106627092 AAGAGGGAAGAAAGGAGAAAGGG + Intergenic
978346749 4:107777973-107777995 GAGGGGGAAGAAAGGAAAAAGGG + Intergenic
978577669 4:110202529-110202551 CAGGGTGAAGGAAAAAGAAAAGG + Intergenic
979417995 4:120466842-120466864 CTGTGGGAAGAAAGGAGGAAAGG + Intergenic
979766484 4:124470454-124470476 AAGGGGGAGGGAAGGAGGAAGGG - Intergenic
980388742 4:132119296-132119318 CAGGGTGCAGAAATAAGGGATGG - Intergenic
980492407 4:133544996-133545018 CAGTGTGAAGAAAGGATTAGAGG + Intergenic
980757104 4:137179136-137179158 CAGGGGGAAAAAAGGACTAAGGG + Intergenic
981000672 4:139825868-139825890 AAGGGAGAAGAGAGGAGGCATGG + Intronic
981081102 4:140640271-140640293 CAGGGGGAAGAAAGGGGAAAGGG + Intronic
981111911 4:140944458-140944480 CTGGATGAAGAAAGGATGAAGGG + Intronic
982740249 4:159050399-159050421 GAGGGGGAAGAAAGGGGGATGGG + Intergenic
982894050 4:160894116-160894138 CAGGGTGAACAAGAGAGAAAAGG + Intergenic
983396476 4:167204155-167204177 GAAGGGGAGGAAAGGAGGAAGGG - Intronic
983622564 4:169775583-169775605 CAGGAGGAAGAAAGGAAAAACGG - Intergenic
984007595 4:174332039-174332061 CATTGGGAAGAAAGGAAGAATGG - Exonic
984359774 4:178713662-178713684 CAGAGAGAAACAAGGAGGAAGGG + Intergenic
984607653 4:181804027-181804049 GAGGGTAAGGGAAGGAGGAAGGG + Intergenic
984775507 4:183478249-183478271 GAGGGAAAAGAAAGGAGGGAAGG - Intergenic
984850111 4:184145261-184145283 CAAGGCAAAGGAAGGAGGAAGGG - Intronic
984872180 4:184335563-184335585 CAGGCTGAAGACAGGATGCAAGG - Intergenic
985034627 4:185825843-185825865 CACTGTGAAGAAAAGAAGAATGG + Intronic
985336969 4:188906156-188906178 GAGGGAGGAGGAAGGAGGAAAGG - Intergenic
985558195 5:568430-568452 CAGGGTTTAGGAAAGAGGAAGGG - Intergenic
986035533 5:3933500-3933522 CAAGGTGAAAAGAGCAGGAAGGG - Intergenic
986076692 5:4345134-4345156 CAGCAGGAAGACAGGAGGAAAGG - Intergenic
986368663 5:7059703-7059725 CAGGGTGAGGACAGGAAAAAAGG + Intergenic
986808902 5:11335037-11335059 AAGGAGGAGGAAAGGAGGAAAGG - Intronic
987233527 5:15919937-15919959 CATGGTGCAGAAAGGAGGTGGGG + Intronic
987250057 5:16090627-16090649 CAACTTAAAGAAAGGAGGAAGGG - Intronic
987533493 5:19151919-19151941 CAGGGTTTAGGAGGGAGGAAGGG - Intergenic
988253628 5:28794731-28794753 CAGAGAGAAGAAAGGATGATAGG - Intergenic
988299770 5:29406789-29406811 GAGGGAGAAGAAATGGGGAAAGG + Intergenic
988514881 5:31895691-31895713 CTGAGTGAAAAAACGAGGAAGGG - Intronic
988675505 5:33428685-33428707 CAGGGAGCAGAGAGGAGCAAAGG - Intergenic
988731309 5:33975880-33975902 CAGGGAGAAGGAAGGGGGAATGG - Intronic
988791887 5:34616085-34616107 CAGAGGGAGGAGAGGAGGAAGGG + Intergenic
989133030 5:38126237-38126259 CATGGAGAAGATGGGAGGAAAGG + Intergenic
989263517 5:39446260-39446282 CCAGGTGAGGAAAGGAGGGAGGG - Intronic
989436979 5:41425636-41425658 CAGGGGTTAGAAAGGAGAAACGG - Intronic
989675978 5:43973186-43973208 CAGGATGAAGACAGGGGCAAAGG + Intergenic
990132325 5:52601361-52601383 CAGAGGGAGGAAAGGAGTAAAGG + Intergenic
990308301 5:54515335-54515357 GAAGGAGAAGAAAGGAGGGATGG + Intergenic
990759667 5:59114608-59114630 CAGAGTGAGGAAAGCAGGAATGG + Intronic
990798011 5:59565900-59565922 CATAGTGAAGAGAGGAGGAGAGG + Intronic
991106528 5:62850285-62850307 GAAGGTGAAGAAAAGATGAAAGG - Intergenic
991249152 5:64540794-64540816 CAGGCAGAAGAAAGGAGGGAGGG + Intronic
991409859 5:66335106-66335128 CAGGGTGAAGCCTGGGGGAAAGG - Intergenic
992305215 5:75430041-75430063 GAGGATGACGAGAGGAGGAAAGG + Intronic
992497897 5:77310903-77310925 AAAGGAGAAGAAAGGAGAAAGGG + Intronic
992540590 5:77760403-77760425 AAAGGAGAGGAAAGGAGGAAAGG - Intronic
992605099 5:78447927-78447949 GAGGGGGAAGGAGGGAGGAAGGG - Intronic
992732736 5:79689572-79689594 CAGGGGGTTCAAAGGAGGAAAGG - Intergenic
992948165 5:81830099-81830121 GTGGGTGAAGAAAGCAGGATTGG + Intergenic
993407650 5:87531533-87531555 AAGAGAGAAGGAAGGAGGAAGGG - Intergenic
993589205 5:89773305-89773327 GAGGGAGAACACAGGAGGAAAGG + Intergenic
993629067 5:90261622-90261644 CAGGGAGAAGAAAAAAGGAGTGG + Intergenic
993688856 5:90973858-90973880 CAGGCAGAAGAAAGAAAGAAAGG + Intronic
993969353 5:94397956-94397978 AAGAAGGAAGAAAGGAGGAAAGG - Intronic
994036239 5:95204287-95204309 CAGGTAGAAGAAAGGACAAAGGG + Intronic
994143900 5:96371473-96371495 CTGGAAGAAGAAAGGAAGAAAGG - Intergenic
994274979 5:97824365-97824387 CACGGTGAAGAAAGTAGTCAAGG - Intergenic
994648177 5:102495769-102495791 AAGGGAGAAGAAGAGAGGAAGGG + Intronic
994681145 5:102889136-102889158 CAGGCTGAAGAAGGGTGGGAAGG - Intronic
995504687 5:112847874-112847896 CAGGTTGAAAAAAGCATGAATGG - Intronic
995548189 5:113253454-113253476 CAAGGTGAAGCAAGCAGGATGGG - Intronic
996167409 5:120242286-120242308 GGGAGGGAAGAAAGGAGGAAGGG - Intergenic
996739749 5:126788044-126788066 CAGGTGGAAGAAAGGAGAGAAGG + Intronic
997232734 5:132256250-132256272 CCAAGTGAAGAAAGGTGGAAGGG - Intronic
998371827 5:141666653-141666675 CAGGGGGAGGACAGGAGAAAGGG + Intronic
998394513 5:141810034-141810056 CAGGCTGAAGAAATGAGGTGGGG - Intergenic
998512825 5:142727941-142727963 GAGGGAGAAGAAAGGAGGGCTGG + Intergenic
999090471 5:148931776-148931798 AAGGGGGAAGGAAGGAGAAAGGG - Intronic
999384984 5:151147763-151147785 CAGCTTGAAAAAAGGAGGAAAGG - Intronic
999513021 5:152272493-152272515 CAGGGAAAAGAAAGGAGTCAAGG - Intergenic
999775343 5:154808434-154808456 GATGGGAAAGAAAGGAGGAAAGG - Intronic
1000616368 5:163432441-163432463 CAGGGTGAAGATTGGAGAGATGG - Intergenic
1000792178 5:165621572-165621594 CAGGCTGAAGAGAGGAAAAAAGG - Intergenic
1000974612 5:167751106-167751128 CAGGGTGGAGAGAGGAAGCAGGG + Intronic
1001451846 5:171832106-171832128 CAGTGGGAGGAAAGAAGGAAAGG - Intergenic
1001556146 5:172638554-172638576 GAGAGGGAAGAAAGAAGGAATGG - Intergenic
1001614214 5:173029453-173029475 CAGGGTGCCTGAAGGAGGAATGG - Intronic
1001732914 5:173973400-173973422 AAGAGTGAAGAATGCAGGAAGGG - Intergenic
1001785334 5:174407688-174407710 CATGGTAAAGAGAGGAAGAAGGG - Intergenic
1002065832 5:176651215-176651237 CAGGGTGCAGAAAGGAGGCTAGG + Intronic
1002301760 5:178261496-178261518 CAGTGTGAAAAAGGCAGGAAAGG + Intronic
1002377005 5:178796045-178796067 AAGGGAGAGGAAAGGAGGGAGGG + Intergenic
1002794374 6:459610-459632 CAAATAGAAGAAAGGAGGAAGGG + Intergenic
1002929877 6:1625688-1625710 AAGAAGGAAGAAAGGAGGAAAGG + Intronic
1003136013 6:3435298-3435320 CAGGAGGAAGAGATGAGGAAGGG - Intronic
1003467693 6:6397177-6397199 CAGGTTCAAGAAAGAAGGGAAGG - Intergenic
1003491766 6:6628337-6628359 GTGGCTGAAGAAGGGAGGAAGGG - Intronic
1003782781 6:9447876-9447898 CAGGCAGAAGAAAGAAGTAAAGG + Intergenic
1003793535 6:9574567-9574589 TGGGGTGAGGCAAGGAGGAAAGG - Intergenic
1004063256 6:12218736-12218758 TAGGGTCAAGAATGGAGGCAGGG - Intergenic
1004310839 6:14543546-14543568 CTGGGGAAAGCAAGGAGGAATGG - Intergenic
1004370568 6:15048800-15048822 CAGTGTGAGGAAAGGATGTATGG + Intergenic
1004448055 6:15719889-15719911 AAAGGGGAAGAAAGGAGGAAAGG - Intergenic
1004455117 6:15785025-15785047 CAGGGATAAGAAAAGAGCAATGG + Intergenic
1004715565 6:18213492-18213514 CAGGGGGAAAAAAGGAGGTGAGG + Intronic
1005021223 6:21420868-21420890 TAGGGTGAGGAGAGGAGGGAAGG + Intergenic
1006033846 6:31197038-31197060 CAGAGTGGAGAAAGGAGGGAAGG - Intergenic
1006202194 6:32304139-32304161 CAGGAAGAAGAAAGAAAGAAAGG + Intronic
1006213168 6:32414592-32414614 AAAAGAGAAGAAAGGAGGAAGGG + Intergenic
1006577691 6:35058157-35058179 GAGGGTGAGGAGGGGAGGAAGGG + Intronic
1006812335 6:36827982-36828004 CAAGGGGAAGCAGGGAGGAAAGG - Intronic
1006895608 6:37468026-37468048 CAGAGGGAAGAAAGGAAGAGAGG - Intronic
1006918150 6:37609400-37609422 GAGGGACAAGAAAGGAGGAGTGG - Intergenic
1007220584 6:40275769-40275791 CAGGGTAAAGAAAGGGAGTAGGG - Intergenic
1007287895 6:40761325-40761347 CGGGGTGAAGAAAAGAGAGAAGG + Intergenic
1007377476 6:41466668-41466690 AAGGGGGGAGGAAGGAGGAAGGG + Intergenic
1007434992 6:41804361-41804383 CAGGGTGAGGGAAGCAGGCAGGG - Intronic
1007485657 6:42178977-42178999 GAGGGTGAGGAAGGGAGGAGAGG + Intronic
1007617130 6:43186754-43186776 CATGGTTAAGAAAAGAGGCAGGG + Intronic
1007837193 6:44682683-44682705 CAGAGAGAGGAAAGGAGGGAAGG - Intergenic
1008131169 6:47721277-47721299 CAGGCTGGAGTGAGGAGGAATGG + Exonic
1008527943 6:52426330-52426352 CAGTTTCAAGAAGGGAGGAAGGG - Intronic
1008721447 6:54358730-54358752 CAGGGTGAAGTAAAAAAGAAAGG - Intronic
1008924760 6:56880125-56880147 CAGGGTGAAGAATGGATAAAAGG - Intronic
1009603973 6:65842308-65842330 GAGGGTGAAGAAGAGATGAATGG - Intergenic
1009677726 6:66847759-66847781 AAGAGTGAGGAATGGAGGAAGGG - Intergenic
1009828410 6:68897691-68897713 CAGAAAGAAGAAAGAAGGAAGGG + Intronic
1009842522 6:69094088-69094110 CAAGGTGAAGAGAGGTGGACAGG + Intronic
1010435847 6:75829958-75829980 CAGGGTGAATACAGTAGGTAAGG + Intronic
1011490847 6:87890303-87890325 AAGGGAGAAGAAAGGAGGACTGG + Intergenic
1011874985 6:91948286-91948308 CAGGGTTTGGAAAGGAGGGAGGG + Intergenic
1012210368 6:96510853-96510875 CAGGGGGAAGAAAGAGGGAAAGG - Intergenic
1012359997 6:98365599-98365621 AGGAGGGAAGAAAGGAGGAAAGG - Intergenic
1012378275 6:98588683-98588705 AAAGGTGAAGAAATGAAGAAAGG + Intergenic
1013313976 6:108923896-108923918 GAGGGGGAAGAAAGAAAGAAGGG - Intronic
1013490448 6:110641618-110641640 AAAGGAGAGGAAAGGAGGAAAGG + Intronic
1013604745 6:111737517-111737539 CAGGGTGAGGTATGAAGGAAAGG + Intronic
1013673505 6:112431459-112431481 GAGGGTAGGGAAAGGAGGAAGGG + Intergenic
1013677359 6:112480305-112480327 GAGGAGGAAGAAAGGAGGGAGGG - Intergenic
1013742875 6:113309456-113309478 CAAGCTGAAGAAAGATGGAAGGG - Intergenic
1013916480 6:115344677-115344699 TAGGATGAGTAAAGGAGGAAGGG - Intergenic
1014176213 6:118334204-118334226 CAGAGTGAGGACAGGAGTAAGGG + Intergenic
1014328359 6:120028079-120028101 CATGGTGGAAACAGGAGGAAGGG + Intergenic
1014412725 6:121146964-121146986 TAGGGTGATGGAGGGAGGAAGGG - Intronic
1014467679 6:121776608-121776630 GATGGGGAAGAAAGAAGGAAGGG - Intergenic
1014776687 6:125519167-125519189 TAGAGGGAAGAAAGGAAGAAAGG - Intergenic
1014856059 6:126402287-126402309 AAGGGAGAGGAATGGAGGAAGGG - Intergenic
1014897622 6:126922633-126922655 CTGGGGGAAGACAGGAGGCATGG - Intergenic
1014905016 6:127015465-127015487 TAGGATGAAAAAAGTAGGAAAGG - Intergenic
1015280027 6:131423137-131423159 GAAGGTGAAGAAGGAAGGAAAGG - Intergenic
1015447727 6:133326735-133326757 CACGGTGAAGGGATGAGGAAGGG - Intronic
1015820550 6:137256184-137256206 CAGGATGAAGAAAGAAAGAAGGG - Intergenic
1016073808 6:139772663-139772685 GAGGGAGAAGGAAGGAGGGAGGG - Intergenic
1016881601 6:148917180-148917202 GAGGGGGAAGAAAGGAGGGTGGG - Intronic
1017017439 6:150113208-150113230 AAGGGGGAAGAAAGGAGGCTGGG - Intergenic
1017074249 6:150602571-150602593 GGCGGAGAAGAAAGGAGGAAAGG - Intronic
1017188191 6:151623787-151623809 CAGGGAGAGGCAAGGAGGGAAGG - Intergenic
1017192252 6:151666932-151666954 GAAGGAGAAGAAAGGAGAAAGGG + Intronic
1017258901 6:152364628-152364650 CAGGGGGAAGGAAGGAAGAAAGG + Intronic
1017500783 6:155020890-155020912 CAGGGTGGAGGAAGAAGAAATGG - Intronic
1017585521 6:155918420-155918442 AAGGGGGAAGAGAGGAAGAAAGG + Intergenic
1017681972 6:156873184-156873206 CGGGTTGAAGAAAAGGGGAATGG + Intronic
1017777196 6:157689500-157689522 CAGGGAGAAGGAAGGAGCAGTGG - Intergenic
1017927736 6:158924725-158924747 GAGGGGGAAGAGAGAAGGAAGGG + Intergenic
1018251592 6:161877252-161877274 CAGGGTCCAGACAGGAGGAATGG - Intronic
1018328095 6:162696325-162696347 CACGCTCAAGAAAGGAGGAAGGG + Intronic
1018341044 6:162851258-162851280 CAGGGTGCAGAAGGGAGGCAAGG - Intronic
1018798832 6:167207441-167207463 CAGTGTGAACCAAAGAGGAAGGG + Intergenic
1019147697 6:169985545-169985567 CAGGGTGAGGAAGGACGGAAAGG - Intergenic
1019168707 6:170116708-170116730 CAGCGGGAAGCAAGGAGGGAGGG - Intergenic
1019339782 7:503517-503539 GAGGGTGAAGGAGGGAGGAGGGG + Intronic
1019599831 7:1875590-1875612 CAGGGAGAGGAAAGGCGGCAAGG + Intronic
1019932111 7:4230469-4230491 CAGGGGGAAGGAAGGAGGGAGGG + Intronic
1020159168 7:5755086-5755108 AAAGGAGAAGAGAGGAGGAAAGG + Intronic
1021191593 7:17626611-17626633 TAGGGGGATGAAAGGAGGAATGG - Intergenic
1021232180 7:18099004-18099026 CAGGTTGGGGAAATGAGGAAGGG + Intronic
1021344160 7:19502947-19502969 TAGAGTGAAGAGAAGAGGAAAGG + Intergenic
1021399084 7:20188545-20188567 GAGAAGGAAGAAAGGAGGAAAGG - Intronic
1021501547 7:21337226-21337248 AATGGGGAAGAAAGAAGGAAGGG - Intergenic
1021559468 7:21955509-21955531 AGGGGTTAAGGAAGGAGGAAGGG - Intergenic
1021657021 7:22882711-22882733 CAGGGTTCACAAAGGAGGAAGGG - Intergenic
1021779932 7:24094076-24094098 AAGGGTGAAGAATGGGAGAAAGG - Intergenic
1021931718 7:25587327-25587349 CATGGTCAAGGCAGGAGGAAAGG + Intergenic
1021983505 7:26077532-26077554 CAGGAAGAAGAAAGGAAGGAAGG + Intergenic
1022137899 7:27466491-27466513 CAGGGGGAAGCAAGTAGGAGGGG + Intergenic
1022337308 7:29433865-29433887 GAGGGGGAGGAAGGGAGGAAGGG + Intronic
1022560842 7:31347261-31347283 AAGGGAGAAAAAAGGAGGCATGG + Intergenic
1022622114 7:31995242-31995264 CAGTGAGAAGAGAAGAGGAAGGG + Intronic
1022684064 7:32578152-32578174 GAGGGAGAAGAAAGGAGGCCTGG + Intronic
1022798620 7:33753485-33753507 CAGGCAAAAGAAGGGAGGAATGG - Intergenic
1022967027 7:35483391-35483413 AAGGGAGGAGAAAGGAAGAAAGG - Intergenic
1023156459 7:37256758-37256780 AAGGGAGAAGGGAGGAGGAAGGG + Intronic
1023351214 7:39321796-39321818 GAGGAGGAAGAAAGGAGGAAGGG + Intronic
1023452769 7:40305059-40305081 CAGGGTGAAGAAAGGAGGAAAGG - Intronic
1023728456 7:43167623-43167645 CAGGAGGAATAAGGGAGGAAAGG + Intronic
1023794815 7:43782894-43782916 CACGGTGAAGCAGGGAGGTATGG + Intronic
1023910080 7:44547692-44547714 AAGAGAAAAGAAAGGAGGAAGGG + Intergenic
1023932153 7:44712546-44712568 CAGTGGGAAGAAAGGAGGTGGGG + Intergenic
1024404856 7:48966962-48966984 TAGGATAAAGGAAGGAGGAATGG - Intergenic
1025078540 7:55963754-55963776 CAGGAGAAAGAAAGGAGGGAAGG - Intronic
1025120867 7:56300800-56300822 GTGGGAGAAGAAAGGAGGGAGGG + Intergenic
1025198702 7:56949411-56949433 GAGGGTGAAGGGAGGAGGGAAGG - Intergenic
1025925419 7:65955683-65955705 GACGGTGAAGAAAGGAGGGAAGG - Intronic
1026095907 7:67346505-67346527 TAGGGTGAGGTATGGAGGAAGGG + Intergenic
1026519888 7:71107481-71107503 TAGGGTGAGGTAAGGGGGAAGGG - Intergenic
1028159484 7:87469378-87469400 CAGGCAGAAGAAAGAAAGAAAGG + Intronic
1028756471 7:94440788-94440810 CTGGGTGAAAAAAGAAGAAAAGG + Intergenic
1028928623 7:96388312-96388334 CAAGGTGAGGAAATGAGGACTGG - Intergenic
1029165280 7:98584875-98584897 CAGAATGAAGGAAGGAGAAAAGG - Intergenic
1029165317 7:98585118-98585140 AAGGAGGAGGAAAGGAGGAAGGG - Intergenic
1029196728 7:98810630-98810652 CAGGGTGGAGAAAGAAAGAAAGG + Intergenic
1029203653 7:98855513-98855535 CAGAGGGAGGAAAGTAGGAAAGG + Intronic
1029609148 7:101617499-101617521 CAGGGTGACAAAAGGAGCAGGGG - Intronic
1029799629 7:102933073-102933095 CATGGAGAAGAAAGAAGAAAAGG + Intronic
1030061615 7:105626007-105626029 CAGGGTGAAAATAAGAGAAAAGG - Intronic
1030134080 7:106229645-106229667 CAGGGAGAAGAAAGAAAGAAAGG - Intergenic
1030379920 7:108800596-108800618 AAGGGTGGAGAAGGGAGGAGGGG - Intergenic
1030541610 7:110837301-110837323 AAGAGTAAAGAAGGGAGGAAAGG + Intronic
1030682496 7:112448843-112448865 TAAGGTGAAGATGGGAGGAAAGG + Intronic
1030739938 7:113096783-113096805 CAGGGAGAAGGATGGAGAAAGGG + Intergenic
1030823701 7:114127822-114127844 CTGGGAGAAGAAAAGAGGAAAGG - Intronic
1030838719 7:114320858-114320880 CCTGTGGAAGAAAGGAGGAAGGG + Intronic
1031070354 7:117154893-117154915 TAGGTTGGAGAAGGGAGGAAGGG + Intronic
1031088169 7:117323559-117323581 CAATGTGAGGAAACGAGGAAGGG + Intergenic
1031089256 7:117333939-117333961 CAGTGGAAAGAAAGTAGGAAAGG + Intergenic
1031363382 7:120874213-120874235 AAGGGAGGAGAAGGGAGGAAAGG + Intergenic
1031483936 7:122306681-122306703 CAGGCTGAAGAAATGGGGGAGGG + Intronic
1031529235 7:122856034-122856056 CAGGCAGAAGGAAGGGGGAAGGG - Intronic
1031669692 7:124527949-124527971 CAGGAGCAAGAAAGGAAGAAGGG + Intergenic
1032073225 7:128822664-128822686 CAGGCTGAAGCAGGAAGGAAAGG + Intergenic
1032286024 7:130539042-130539064 CAGAGGGCAGAGAGGAGGAAAGG + Intronic
1032358433 7:131231339-131231361 CAGGGGGAAGAAACGAGAATTGG - Intronic
1032515474 7:132503380-132503402 GAAGGTGAAGAAAGGAGAGAAGG + Intronic
1033042014 7:137927431-137927453 GAGGGGAAAGGAAGGAGGAAGGG + Intronic
1033390955 7:140926710-140926732 AAGGGTGATGAAAGGGGAAAAGG - Intergenic
1033441137 7:141379792-141379814 CATAATGAAGAAAGGAAGAAAGG - Intronic
1033499635 7:141934961-141934983 CAGGGGAATGAAAAGAGGAAAGG - Intronic
1033619099 7:143046365-143046387 CATGGTAAAGGAAGGAGGTAAGG - Intergenic
1033928643 7:146495758-146495780 GATGGTGAAGAAATGAGAAAGGG + Intronic
1033969772 7:147025325-147025347 CAGGGAGAAGAAAGGGGGGAGGG + Intronic
1034006602 7:147478984-147479006 CAGGGTGACGACAGGAAGAAAGG + Intronic
1034190174 7:149207726-149207748 CTGGGTGGAGAGACGAGGAAGGG + Intronic
1034859046 7:154580741-154580763 CGGGGTGAAGAAGAGAGGAATGG + Intronic
1035266327 7:157692034-157692056 CAAGGAGAAGAAAGGAAGAGGGG + Intronic
1035331864 7:158101835-158101857 CAGAATGAAGAAGGGAGGAGTGG - Intronic
1035332937 7:158108057-158108079 CAGGGTGAATGCAGTAGGAAGGG - Intronic
1035446911 7:158949423-158949445 CAGGGAGTAGACAAGAGGAAGGG + Intronic
1035776374 8:2191452-2191474 GAGGGGGAAGGGAGGAGGAAGGG - Intergenic
1035776443 8:2191588-2191610 GAGGGGGAAGGGAGGAGGAAGGG - Intergenic
1035776538 8:2191767-2191789 GAGGGGGAAGGGAGGAGGAAGGG - Intergenic
1035776569 8:2191830-2191852 GAGGGGGAAGGGAGGAGGAAGGG - Intergenic
1036756493 8:11474785-11474807 CAGGGAGTAGGAAGGAGAAAGGG + Intergenic
1037157957 8:15728802-15728824 CAGAGTCTAGAAAGAAGGAAAGG + Intronic
1037457346 8:19076785-19076807 AAGGGTGAGGAGAGAAGGAAGGG - Intronic
1037747924 8:21661577-21661599 CAGAAGGAAGAAAGGAAGAAAGG + Intergenic
1037911784 8:22747973-22747995 CTGGGTGGAGAGCGGAGGAAAGG + Intronic
1037935955 8:22915191-22915213 CAGGTGGAAGAATGGAAGAAAGG - Intronic
1038020031 8:23544947-23544969 GAGGGTGGAAACAGGAGGAAGGG + Intronic
1038046629 8:23770997-23771019 GAGGATGAAGGAAGGGGGAAAGG + Intergenic
1038047477 8:23777955-23777977 CAGGGAGGGGAGAGGAGGAAAGG + Intergenic
1038687825 8:29734442-29734464 CAGGGTAGAGAAAGGAGTGATGG - Intergenic
1038812679 8:30866288-30866310 AAGGGAGAAAAAAGGAGAAAAGG + Intronic
1039053696 8:33516809-33516831 CGGGGTGAAGGAAATAGGAATGG + Intergenic
1039069635 8:33637689-33637711 TTGGGTGATGAAAGGAGGAAGGG + Intergenic
1039373624 8:37011839-37011861 GAGGGAGGGGAAAGGAGGAAAGG - Intergenic
1039433793 8:37545870-37545892 CAGGGTGAAGAAAGGAAATGGGG - Intergenic
1040280465 8:46039424-46039446 CGGGGCGGAGAGAGGAGGAAAGG + Intergenic
1040517127 8:48144432-48144454 CAGGGTGAAGAGCGGAGGGGAGG + Intergenic
1040956714 8:52987530-52987552 AGGGATGATGAAAGGAGGAAGGG - Intergenic
1041231400 8:55756769-55756791 GAGGGGGAAGAGAGGAGGCAAGG + Intronic
1041566245 8:59281879-59281901 GGGGAGGAAGAAAGGAGGAAGGG - Intergenic
1042533111 8:69834351-69834373 CTGAGAAAAGAAAGGAGGAAGGG + Intronic
1042663968 8:71185975-71185997 GAGGGAGAGGAAAAGAGGAAGGG - Intergenic
1043323641 8:79022406-79022428 CAAGGTGGGGAAAGGAAGAAGGG + Intergenic
1043706892 8:83361381-83361403 AACTGGGAAGAAAGGAGGAAAGG - Intergenic
1044117799 8:88355557-88355579 CAAGGAAGAGAAAGGAGGAAGGG + Intergenic
1044303149 8:90608511-90608533 CAAGGGGAAAAGAGGAGGAAGGG - Intergenic
1044613298 8:94115404-94115426 AAGGTTGAAGAAAGGAGGAGTGG - Intergenic
1044875796 8:96665173-96665195 CAGGGTAAAGAATGGCAGAAAGG + Intronic
1044946841 8:97397326-97397348 CAGAGTGAAGAAGTGAGGGAGGG - Intergenic
1045426787 8:102075009-102075031 CAGGCAAAAGGAAGGAGGAAGGG + Intronic
1045501709 8:102748793-102748815 CAGAGTGAAGAATGGAGGGGAGG + Intergenic
1045546448 8:103133224-103133246 GAGGTGGAAGGAAGGAGGAAAGG + Exonic
1045675536 8:104603746-104603768 AAAGGAGAAGAAAGGAAGAATGG + Intronic
1045922601 8:107548572-107548594 CAAGGTGAAGACAAAAGGAATGG + Intergenic
1046190428 8:110788432-110788454 CAGGTTGAGGTATGGAGGAAGGG - Intergenic
1046326913 8:112660919-112660941 CAGGATTAAGAAATGAGGCACGG + Intronic
1046483241 8:114851113-114851135 GAGGGGGAAGGAAGGAGGGAAGG + Intergenic
1046595346 8:116255045-116255067 CAGGGGGAAGAAAGGGAGAGAGG - Intergenic
1046679461 8:117152401-117152423 CAGGGAGCAGAAAGGAGAAAGGG - Intronic
1047127597 8:121979949-121979971 CAGGGTGCAGAGAGGACGAGTGG - Intergenic
1047341246 8:123982519-123982541 CAAGATGAAGAGAGGAGGGAGGG - Intronic
1047725432 8:127679959-127679981 CAGGGTGGGGAAGGGAGAAAGGG + Intergenic
1047821776 8:128529108-128529130 CAGGGAGCAGAAAGCAGTAAAGG - Intergenic
1048048176 8:130792731-130792753 CAGGGTCAAGAGTGGAAGAAGGG - Intronic
1048048669 8:130796770-130796792 AAGGATGAAAAGAGGAGGAAAGG - Intronic
1048070263 8:131013363-131013385 TAGGGTAAGGGAAGGAGGAAGGG + Intronic
1048148159 8:131865665-131865687 TAGGGGAAAGCAAGGAGGAAGGG - Intergenic
1048299871 8:133243679-133243701 AAGGAGGAAGAAAGGAGGCAGGG + Intronic
1048413004 8:134195219-134195241 GGGAGGGAAGAAAGGAGGAAGGG - Intergenic
1048461300 8:134623759-134623781 CAGGGAGAAGAGGGGAGGAGAGG - Intronic
1049891621 9:74879-74901 GAGGCTGAAGAAAAGAAGAATGG + Intergenic
1049982697 9:919504-919526 CAGGATAAGGAAAGAAGGAATGG - Intronic
1050265838 9:3888677-3888699 GAGTGTGAATAAAGGAGGAAAGG - Intronic
1050265983 9:3890144-3890166 CAGGTGGAAGAAAGGAGAAATGG - Intronic
1051014820 9:12461985-12462007 GAGGGGGAAGAAAGGAAGAAGGG - Intergenic
1051328275 9:15997088-15997110 AAAGGGGAAGAAAGGAGGATTGG + Intronic
1051437154 9:17044897-17044919 AAGACTAAAGAAAGGAGGAAAGG + Intergenic
1051896979 9:21996886-21996908 CATGGTGGGGAAAGGAGAAAAGG + Intronic
1052024668 9:23561240-23561262 CTGGGGGAAGAAGGGATGAAGGG + Intergenic
1052049585 9:23830208-23830230 CAGGGAGAAGAACGGGGGGAGGG - Intergenic
1052228482 9:26118450-26118472 AAGGGGGACGAAAGGAGAAACGG + Intergenic
1052325769 9:27215324-27215346 AAGGGGGAAGAAAGAAGGATTGG + Intronic
1052416487 9:28184511-28184533 TATGGTTAATAAAGGAGGAAGGG + Intronic
1053020590 9:34691395-34691417 CAGGGGGAAGAAGGGGGGCAGGG - Intergenic
1053733049 9:41075973-41075995 GAGGCTGAAGAAAAGAAGAATGG + Intergenic
1054351956 9:64025509-64025531 TAGGGGGAGGAAAGGAGGCAAGG - Intergenic
1054695373 9:68355586-68355608 GAGGCTGAAGAAAAGAAGAATGG - Intronic
1055074234 9:72197274-72197296 CAGGGAGAGGGAAGGAGGCAAGG - Intronic
1055659213 9:78485352-78485374 CAGGGAGAAAACAGGAGGGAAGG - Intergenic
1055679489 9:78700588-78700610 CGGGGTGATGAGAGGAGAAAAGG - Intergenic
1056766574 9:89447842-89447864 CATGGGGAACAAAGGAGCAAAGG - Intronic
1056896779 9:90558901-90558923 CGGGAAGAGGAAAGGAGGAATGG + Intergenic
1056914333 9:90731726-90731748 AAGGGTGGAGAAAGAAGGAAAGG - Intergenic
1057321179 9:94014435-94014457 CAGGGGGAGGGAGGGAGGAAAGG - Intergenic
1057736901 9:97670974-97670996 CAGAATGATGAAAAGAGGAAGGG - Intronic
1057907818 9:98995668-98995690 CAGGGTGGAGGTGGGAGGAAAGG - Intronic
1057954533 9:99396935-99396957 CGGGGTGAGGAAAGGAAGAGGGG + Intergenic
1058324294 9:103676408-103676430 AACGGTGAGGAAAGGAGAAAAGG - Intergenic
1058624944 9:106925237-106925259 CATGGTGAGGAAAGGACAAAAGG - Exonic
1058935795 9:109768059-109768081 AACAGTGAAGGAAGGAGGAAGGG + Intronic
1058935821 9:109768198-109768220 CAGGGAGAAAAAAGGAAGGAAGG + Intronic
1059257731 9:112946006-112946028 AAGGGAGAGGAAAGGAGGCAAGG + Intergenic
1059669665 9:116480103-116480125 ATGGGTGAAGAAAGGAAGGAAGG + Intronic
1059768366 9:117404873-117404895 GATGGGGAAGAAAGGAGGGAAGG + Intronic
1059976419 9:119722720-119722742 CAGGAAGAAAAGAGGAGGAAAGG - Intergenic
1060641389 9:125241765-125241787 CGGGGTGAGGGATGGAGGAAGGG - Intergenic
1060816720 9:126639023-126639045 AAGGGGGAGGAGAGGAGGAAAGG + Intronic
1060851075 9:126876225-126876247 CAGGGAAAAGAAGGAAGGAAGGG - Intronic
1060992960 9:127859137-127859159 GAGGGTAAACAAAGAAGGAAGGG - Intergenic
1061218859 9:129237308-129237330 CAGAGAGAGGAAGGGAGGAAGGG + Intergenic
1061246187 9:129402228-129402250 GAGGGTGAAGGAGGGAGGAGGGG - Intergenic
1061273948 9:129558786-129558808 CAGGGTGAGGGAAGGAAGGAAGG + Intergenic
1061391893 9:130321398-130321420 CAGGCAGAAGAATTGAGGAAAGG - Intronic
1061495392 9:130971038-130971060 AGGGAGGAAGAAAGGAGGAAGGG + Intergenic
1062050496 9:134444380-134444402 GAGGGGGAAGGAAGGAGGGAGGG - Intergenic
1062050625 9:134444713-134444735 AAGGGGGAAGGAAGGAGGGAGGG - Intergenic
1062158299 9:135066321-135066343 CAGGGAGAGGACAGGAGGATCGG - Intergenic
1062166203 9:135108762-135108784 CAGGGAGGACAAAGCAGGAAGGG - Intronic
1062171643 9:135138036-135138058 TTGGGTGAAGGAAGGAGGCAGGG - Intergenic
1202802113 9_KI270720v1_random:9572-9594 GAGAGGGAAGAAAGGAGGGAAGG - Intergenic
1185552319 X:992992-993014 GAGGGGAAAGAAAGGAAGAAAGG + Intergenic
1185575589 X:1169341-1169363 GAGGGGGAAGGGAGGAGGAAGGG + Intergenic
1185631091 X:1516277-1516299 AGGGGTGAAGAAGGGAGGAATGG - Intronic
1185719974 X:2373628-2373650 CAGGTTGGAGAAAAGGGGAAGGG + Intronic
1185734296 X:2485610-2485632 CAGAGGGAAGGAAGGAGGGAGGG + Intronic
1185747671 X:2584860-2584882 GAGAGTGAGGAAAAGAGGAAAGG - Intergenic
1185869225 X:3649796-3649818 GAGGGAGAGGAAAGGAGGGAGGG + Intronic
1186079269 X:5912827-5912849 CAGGGAGAGGGAAGGAGGGAAGG + Intronic
1186166610 X:6833256-6833278 ATGGATGAAGAAAGGATGAATGG + Intergenic
1186200809 X:7153397-7153419 CAGGAGGAAGACAGGAGGAAAGG - Intergenic
1186239979 X:7555369-7555391 AAGGGAGAAGAGAGGAGGGAAGG + Intergenic
1186610647 X:11135175-11135197 CAGGGTGGGGAAAGGTGGCATGG - Intergenic
1186613058 X:11157356-11157378 CAGGTGCAAGAAAGGAGTAAAGG - Intronic
1186655715 X:11609672-11609694 CAGGCAGAAGAAAAGTGGAAAGG + Intronic
1187249453 X:17583679-17583701 CAGGGTGAGGCAAGGTGGGATGG - Intronic
1187283751 X:17883122-17883144 AAGGGTGAGGGAAGGAGGAAAGG + Intergenic
1189078012 X:37938646-37938668 AAGAGGGAAGGAAGGAGGAAAGG - Intronic
1189288111 X:39866454-39866476 AAGGGGGAAGAAAGAAGGGAGGG + Intergenic
1189549888 X:42082144-42082166 CGGGGTTAAGAAATGGGGAAAGG - Intergenic
1189556607 X:42151882-42151904 CAGATAGAAGAATGGAGGAAGGG - Intergenic
1190413727 X:50161992-50162014 CAGGGTGAGCTATGGAGGAAAGG + Intergenic
1191857727 X:65640743-65640765 GAGGGCAGAGAAAGGAGGAAAGG + Intronic
1191873468 X:65770046-65770068 CAGGATGAAGAAAGGGTGAAGGG - Intergenic
1191901591 X:66046312-66046334 TAGGGTGAAGAAGGTAGGACTGG + Intergenic
1191947253 X:66548472-66548494 TAGGGTGAAAACAGCAGGAAAGG + Intergenic
1192048543 X:67701937-67701959 AAGGGTGAAGAAGGGAGGCAGGG + Intronic
1192215674 X:69156583-69156605 CAGGGAGGAAACAGGAGGAAGGG + Intergenic
1192264322 X:69528851-69528873 CAGGGGGTAGAGAGGAAGAAGGG - Intronic
1192434605 X:71135445-71135467 CAGGGTGAAGGAAAGAGGGTGGG - Intronic
1192596064 X:72409625-72409647 CCAGTTGAAGAAAGGAGTAAGGG - Intronic
1192717955 X:73663760-73663782 CAGGGAAAAGAAAGGGGAAAGGG - Intronic
1193329375 X:80218487-80218509 CATGTTGAAAACAGGAGGAAGGG - Intergenic
1194223181 X:91222650-91222672 AGGGGTGAAGGAAGGATGAAGGG + Intergenic
1194721554 X:97346391-97346413 GAGGGAGAAGAGAGGATGAAGGG - Intronic
1194869085 X:99105331-99105353 CAGGGAAAACAAAGCAGGAAAGG - Intergenic
1195120456 X:101745087-101745109 CAGGAGGAAGGGAGGAGGAAAGG + Intergenic
1195551723 X:106179309-106179331 CAAGGTGGAGAAAGGAGAGAAGG - Intronic
1195579031 X:106480831-106480853 TAAGGTGAAAAAAAGAGGAATGG + Intergenic
1195946655 X:110221484-110221506 TATGGTTAAGGAAGGAGGAAAGG + Intronic
1196018588 X:110965463-110965485 GAGGCTGAGCAAAGGAGGAAGGG - Intronic
1196541586 X:116916879-116916901 AAGGGTGGAGAAAGGGAGAAGGG - Intergenic
1196995583 X:121379513-121379535 CAAGGAGAAGAATGGAGCAAAGG - Intergenic
1197419663 X:126223219-126223241 TAGGGTGAAGAGTGGAGGAATGG - Intergenic
1197868583 X:131044447-131044469 CAAAGAGAAGAGAGGAGGAACGG + Intergenic
1198878968 X:141258014-141258036 CAGGGAGAAGAAATTTGGAATGG + Intergenic
1199264648 X:145817099-145817121 GAGGAAGAAGAAAGGAGAAAAGG + Intergenic
1199297929 X:146180399-146180421 TAGGAGGAAGACAGGAGGAAGGG - Intergenic
1199404202 X:147436829-147436851 CTGGGTGAAGAAGGGAGCACAGG + Intergenic
1199452431 X:147991500-147991522 GAAGGTAAAGAAAGCAGGAAAGG - Intronic
1199618806 X:149680931-149680953 CAGGGAAAAGAAAGGGGAAAGGG - Intergenic
1199623836 X:149722318-149722340 CAGGGAAAAGAAAGGGGAAAGGG + Intergenic
1199877518 X:151946184-151946206 CAGTGATAAGAAAGGAGGCAGGG - Intergenic
1199953642 X:152725355-152725377 AAGGGGGAAGAGAGGAGGGAGGG + Intergenic
1199956038 X:152743095-152743117 AAGGGGGAAGAGAGGAGGGAGGG - Intergenic
1200042312 X:153379351-153379373 CATGGTGAAGAAAGGAGGCCTGG + Intergenic
1200559661 Y:4686062-4686084 AGGGGTGAAGGAAGGATGAAAGG + Intergenic
1201060722 Y:10043212-10043234 CAAGTTGAAGAAAGCAGGACAGG + Intergenic
1201146330 Y:11067206-11067228 CAGGGAGAGGAAGGGAGGGAGGG + Intergenic
1201575861 Y:15460857-15460879 AATGAGGAAGAAAGGAGGAAAGG - Intergenic
1201910128 Y:19125406-19125428 GAGGGAAAAGAAAGGAGGTAGGG + Intergenic
1202049571 Y:20766571-20766593 AAGGCAGGAGAAAGGAGGAAGGG + Intronic