ID: 1023454920

View in Genome Browser
Species Human (GRCh38)
Location 7:40328362-40328384
Sequence GAACAGTCCTTGAGCAATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023454918_1023454920 5 Left 1023454918 7:40328334-40328356 CCTATTAACAGTTCCATCTATTT 0: 1
1: 0
2: 0
3: 20
4: 244
Right 1023454920 7:40328362-40328384 GAACAGTCCTTGAGCAATATAGG 0: 1
1: 0
2: 1
3: 8
4: 87
1023454919_1023454920 -8 Left 1023454919 7:40328347-40328369 CCATCTATTTAATGAGAACAGTC 0: 1
1: 0
2: 1
3: 12
4: 175
Right 1023454920 7:40328362-40328384 GAACAGTCCTTGAGCAATATAGG 0: 1
1: 0
2: 1
3: 8
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023454920 Original CRISPR GAACAGTCCTTGAGCAATAT AGG Intronic
912440817 1:109696420-109696442 GCACAGTCCTTGAGCATAGTAGG + Intronic
914972829 1:152326569-152326591 GAACAGTAGTGGACCAATATGGG - Intergenic
917838437 1:178958911-178958933 GCACAGTGCTTGATCAATACTGG - Intergenic
918471741 1:184882399-184882421 GAACAGTCCTTGACTATCATGGG - Intronic
920112934 1:203599796-203599818 GAACTGTCCTAGAGATATATGGG - Intergenic
921335532 1:214081899-214081921 GAACAGCCTTTGAGAAATGTGGG + Intergenic
922003694 1:221506025-221506047 GAACAGTCTTAAAGAAATATGGG + Intergenic
924683150 1:246258883-246258905 AAACAGTCTTTGAGAAATATGGG - Intronic
1067840087 10:49668762-49668784 GAACAGGATCTGAGCAATATGGG + Intergenic
1071707068 10:88010821-88010843 GAACAGTGCTTGACCCATAATGG - Intergenic
1078742428 11:14079738-14079760 GATCAGTACTTGGGCAATAAAGG - Intronic
1081127205 11:39336008-39336030 GAACAGCTCATGAGCTATATGGG + Intergenic
1083706678 11:64521365-64521387 CATCAGTCCTTGAGAAATCTGGG + Intergenic
1085438279 11:76531158-76531180 GAAGAATCCTTAAGAAATATAGG - Intronic
1092674677 12:10902342-10902364 ATACAGTCTTAGAGCAATATGGG + Intronic
1097535327 12:60862636-60862658 AAACAGACCTTTAGCATTATAGG + Intergenic
1101790053 12:107918114-107918136 GAGCAGAACTTGAGAAATATGGG + Intergenic
1106057005 13:26247393-26247415 AAATAGTGCTTGAGCAAAATGGG - Intergenic
1110968111 13:81726500-81726522 GAAGAGTCCCTGAGCATTCTCGG + Intergenic
1113115881 13:106874410-106874432 GAACAAACCTTGAGCAAGAAAGG - Intergenic
1114286277 14:21246736-21246758 CAACTGACCTTGAACAATATGGG + Intronic
1115831700 14:37349861-37349883 GAACAGTCATTGCTTAATATTGG + Intronic
1125248908 15:37676781-37676803 GAACAGACCTGGAGCCCTATGGG + Intergenic
1127369695 15:58327417-58327439 AAAAAGTCTTTGAGAAATATGGG - Intronic
1129343928 15:74904845-74904867 GAACAGGCCTTGAATAATACTGG + Intronic
1138092307 16:54185583-54185605 GAACAGTCCCTGAGAAACACAGG - Intergenic
1139072890 16:63404344-63404366 AAACAGTCTCTGAGAAATATGGG - Intergenic
1148254447 17:46116761-46116783 GAAAAGTTCTTGAGCTGTATTGG - Intronic
1153060671 18:991627-991649 CACCAGTGCATGAGCAATATTGG + Intergenic
1156878223 18:42042513-42042535 AAACAATCCTGGAGTAATATGGG - Intronic
1157557540 18:48622499-48622521 GAAAAGTCCTTGAGGAATGTGGG + Intronic
1157935919 18:51873073-51873095 GCAAAGTCTTTGAGGAATATGGG - Intergenic
1157944143 18:51959687-51959709 GAACAGTTCTTCAGAGATATAGG - Intergenic
1158246286 18:55435849-55435871 GAACAGGCCAAGAGAAATATAGG - Intronic
1159792575 18:72800755-72800777 GAACAGTGCTTGGGCATAATAGG + Intronic
928171434 2:29007072-29007094 AAACAGTCCTGGAACAATTTTGG - Intronic
930166974 2:48212520-48212542 GGACATTCCTTGAGCAGTCTAGG - Intergenic
937035811 2:118780997-118781019 GAACAATGCCTGTGCAATATTGG - Intergenic
939646068 2:144700622-144700644 GAACTGCCCTTAAGCAAGATGGG + Intergenic
942981637 2:182091062-182091084 GAAAAGTCCTTCATCAATACAGG - Intronic
944118650 2:196216315-196216337 CATCAGTCCTTGATCAATGTCGG + Intronic
1169034099 20:2435694-2435716 GCTCAGTCCTGGAGCAAGATTGG - Intergenic
1169545648 20:6648055-6648077 GAGCAGTCCTCAAGCAATAAAGG + Intergenic
1170733025 20:18990357-18990379 ACACTGTCCTTGTGCAATATGGG - Intergenic
1170736251 20:19016236-19016258 GGACAGTCCTTGACCAATGGGGG + Intergenic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1182793851 22:32976192-32976214 GTACTGTCCTTGTGTAATATTGG - Intronic
952324976 3:32312887-32312909 GAACAGCCCTGGACCAATAAAGG - Intronic
953117596 3:40008631-40008653 GAACAGCACTTCAGCAATATTGG + Intronic
956768689 3:72506328-72506350 GAACAGACATTTAGCAATAATGG - Intergenic
957227287 3:77466205-77466227 GAACATTTCTTGAAGAATATAGG + Intronic
958622869 3:96584043-96584065 GAACAGTCAATGAGCATGATAGG - Intergenic
959947990 3:112147932-112147954 GCAAAGTCTTTGAGAAATATGGG - Intronic
965337042 3:167438795-167438817 CAACAGTCCATAATCAATATGGG - Intergenic
967453616 3:189654968-189654990 GAACAGTTCTTGAACTATATAGG + Intronic
971084118 4:23250305-23250327 GTACTACCCTTGAGCAATATAGG + Intergenic
971361295 4:25940844-25940866 GAAGAGTCCATGAGCAATAGGGG + Intergenic
972375720 4:38468221-38468243 AAACTGTCCTTGAGGAATCTTGG - Intergenic
977059400 4:92238519-92238541 GCACAGGGCTTGAGGAATATGGG - Intergenic
978261768 4:106768475-106768497 GAAGAGCCCTTGAGCCTTATGGG + Intergenic
983839520 4:172439262-172439284 GAACAGTCTTTGTGGAATATTGG - Intronic
985066695 4:186129302-186129324 GGTCAATCCTTGACCAATATTGG - Intronic
988217822 5:28299493-28299515 AAACAATCCTGGAGAAATATAGG - Intergenic
993782497 5:92085197-92085219 GAATAGTCCTTGAACAAATTAGG - Intergenic
998832852 5:146178288-146178310 GAACAGTTCTTTAACAATTTTGG - Intronic
998974184 5:147626222-147626244 GAACAGACCATGAGCACTTTAGG + Intronic
1008767040 6:54930509-54930531 TAAAAGTCCTTGAGCAATCTTGG - Intronic
1010411209 6:75563917-75563939 GAACAGTCTTCAAGAAATATGGG + Intergenic
1011310957 6:85978994-85979016 GAACAGTCTTTGACAAATATGGG + Intergenic
1014279959 6:119431192-119431214 GAACAGTCCTTGAGAAAACATGG + Intergenic
1015419334 6:132987930-132987952 GGCCAATCCTTGAGCAATTTTGG - Intergenic
1019382235 7:729810-729832 AAACAGTCGCTGAGCAAAATGGG - Exonic
1022660070 7:32358640-32358662 CAACAGTCATTGAGCACTACTGG + Intergenic
1023454920 7:40328362-40328384 GAACAGTCCTTGAGCAATATAGG + Intronic
1023541291 7:41269424-41269446 GAAAAATCCTTGAGCTTTATGGG + Intergenic
1025757814 7:64362018-64362040 GAACTTTCCTTCAGCAAAATTGG + Intergenic
1033131595 7:138749999-138750021 AAAGAGTGCTTGAGCAATCTAGG - Intronic
1041863775 8:62544722-62544744 AAACAATCCTTGAACAACATGGG + Intronic
1043413604 8:80026557-80026579 GCACAGTCCTTGACCCATAGTGG - Intronic
1043610186 8:82053513-82053535 GAAAAATGCTTGAGCAATTTTGG - Intergenic
1044308395 8:90664819-90664841 GAACAGTCTTCAAGAAATATTGG - Intronic
1045296056 8:100872467-100872489 GAACAGACATTTAGTAATATTGG + Intergenic
1046709617 8:117495710-117495732 GTAAAGTCTTTGAGAAATATGGG - Intergenic
1049051606 8:140201352-140201374 GAACAGTGTTTGGGAAATATAGG - Intronic
1049559692 8:143303433-143303455 GAGGATCCCTTGAGCAATATAGG + Intergenic
1050295351 9:4198530-4198552 GAACAGTCTTTGAGAAATATGGG + Intronic
1050687917 9:8192128-8192150 GAACAGCCTTTAAGAAATATGGG + Intergenic
1051859331 9:21606621-21606643 AACCAGTCCTTGAAAAATATGGG - Intergenic
1054769891 9:69073811-69073833 GAACAGTTTTTAAGCTATATAGG + Exonic
1057164124 9:92913141-92913163 GAAACGTCTTTGAGCAAGATTGG + Intergenic
1186102876 X:6175396-6175418 TAATAGTACTTGAGAAATATTGG - Intronic
1188256952 X:27974269-27974291 CAACAGTCCTTGAGCCAAAATGG + Intergenic
1188808413 X:34620665-34620687 GAAAAAGACTTGAGCAATATGGG - Intergenic
1189775005 X:44462653-44462675 GAACAGGGCTTGAGGAAAATGGG + Intergenic
1192767525 X:74157345-74157367 GAAAAGCCTTTGAGAAATATGGG + Intergenic
1198735244 X:139777496-139777518 GCAAAGTCTTTGAGAAATATGGG + Intronic
1199334295 X:146600401-146600423 GAAGAGCCCTTGAGCATTAAGGG - Intergenic