ID: 1023456874

View in Genome Browser
Species Human (GRCh38)
Location 7:40349056-40349078
Sequence GAGGATATACAGAAGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 618
Summary {0: 1, 1: 1, 2: 4, 3: 39, 4: 573}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023456874_1023456879 3 Left 1023456874 7:40349056-40349078 CCACCCTCCTTCTGTATATCCTC 0: 1
1: 1
2: 4
3: 39
4: 573
Right 1023456879 7:40349082-40349104 GAATGAGTTCTCACGTATATTGG 0: 1
1: 0
2: 0
3: 4
4: 60
1023456874_1023456881 27 Left 1023456874 7:40349056-40349078 CCACCCTCCTTCTGTATATCCTC 0: 1
1: 1
2: 4
3: 39
4: 573
Right 1023456881 7:40349106-40349128 TGATGTTTGCTGGCAAACAATGG No data
1023456874_1023456880 17 Left 1023456874 7:40349056-40349078 CCACCCTCCTTCTGTATATCCTC 0: 1
1: 1
2: 4
3: 39
4: 573
Right 1023456880 7:40349096-40349118 GTATATTGGCTGATGTTTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023456874 Original CRISPR GAGGATATACAGAAGGAGGG TGG (reversed) Intronic
900332024 1:2140047-2140069 GAGGCTATAGAGAGTGAGGGTGG + Intronic
900818745 1:4870261-4870283 GAGGACATACTGGAGCAGGGTGG + Intergenic
900892318 1:5458402-5458424 AAGGAAAGAAAGAAGGAGGGAGG - Intergenic
900996057 1:6124284-6124306 GAGGACACACAGAGGGTGGGAGG - Intronic
901151502 1:7106229-7106251 GGGGATACACTGAGGGAGGGAGG + Intronic
901404049 1:9034130-9034152 GAAGATATCCAGAAGGAAGGTGG - Intergenic
901595571 1:10382837-10382859 GGGGAGAAACAGAAGAAGGGAGG + Intergenic
902137953 1:14326906-14326928 GAGGCTATAAAGCAGGATGGGGG - Intergenic
902768871 1:18634268-18634290 GGGGAGATGCAGAAGGAGAGAGG - Intronic
903166357 1:21523413-21523435 GAGTCTTTACAGAAGGAGGCAGG - Intronic
903292919 1:22326074-22326096 GAAGATTCACAGAGGGAGGGAGG - Intergenic
903663214 1:24991294-24991316 GGGCATATTCAGAAGGAGTGAGG - Intergenic
904712143 1:32438247-32438269 GAGGATATACTGAAGCATGTTGG - Intergenic
904778383 1:32925785-32925807 GAAGAGATAGAGAAAGAGGGAGG + Intergenic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
905257366 1:36693465-36693487 GAGGAGAGACAAAAGGAGGAAGG + Intergenic
905258069 1:36698235-36698257 GTGTATGTACAGGAGGAGGGGGG - Intergenic
905277841 1:36830458-36830480 GAAGTTATACTGAATGAGGGTGG + Intronic
906340305 1:44973862-44973884 AAGGTTATAGAGATGGAGGGTGG + Intronic
906920908 1:50063571-50063593 GAGGTCTTACAGAAAGAGGGTGG - Intronic
907656988 1:56353629-56353651 GAGGATTTTGAGAAGGAGGAAGG - Intergenic
908495275 1:64688634-64688656 GAGGCTGGACAGAAGGAAGGTGG - Intronic
908916734 1:69136248-69136270 GAGGAGAAAGGGAAGGAGGGAGG + Intergenic
909252151 1:73371726-73371748 GAGCATATAGAGAAGGTGTGGGG - Intergenic
909561834 1:77016181-77016203 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561842 1:77016205-77016227 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561850 1:77016229-77016251 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561858 1:77016253-77016275 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561866 1:77016277-77016299 GAGGAGATACAGGAGGATGAGGG - Intronic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
912755774 1:112323913-112323935 GATGATAGACAGATGGAGGGAGG + Intergenic
913099395 1:115549379-115549401 GTAGAGACACAGAAGGAGGGGGG + Intergenic
913309332 1:117472183-117472205 GAGGACATAGAGAAGGCGGAAGG - Intronic
915694912 1:157730099-157730121 GAGAACATACAGAAGAAGAGTGG + Intergenic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
917405894 1:174708489-174708511 AAGGATTAACAGAAGCAGGGTGG + Intronic
917881328 1:179339488-179339510 GAGGATAAAGAGAATGAGGAGGG - Exonic
918057047 1:181031174-181031196 AAGGAGAGAGAGAAGGAGGGAGG - Intergenic
918203779 1:182291296-182291318 CAGGAAATACATATGGAGGGGGG + Intergenic
919614183 1:199784978-199785000 GAGGCTAGAGAGAAGGTGGGAGG - Intergenic
919823048 1:201484847-201484869 GGGGATCTTCAGCAGGAGGGTGG - Intronic
919836138 1:201574781-201574803 GAGGATAAACAGAGGCAGGGAGG - Intergenic
919853812 1:201692191-201692213 GTGGATATAGAGAAGCAGGCAGG + Intronic
920717528 1:208354701-208354723 GAGGAGAGTGAGAAGGAGGGAGG + Intergenic
921152103 1:212411029-212411051 GAGGTCATACAGGAGTAGGGTGG - Intronic
921370705 1:214419938-214419960 GAGGATAGAGGGATGGAGGGAGG - Intronic
921626101 1:217379514-217379536 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
921962153 1:221047279-221047301 GAGGGTGAACAGAAGTAGGGTGG + Intergenic
922014410 1:221630506-221630528 GAGGAGGGACAGAAGCAGGGAGG + Intergenic
922205272 1:223441006-223441028 GAGGCTATACTGGAGTAGGGTGG - Intergenic
922575711 1:226659513-226659535 GTGGATACACAGAAGGGAGGAGG - Intronic
924470673 1:244340166-244340188 GAGCATACACTGAGGGAGGGAGG - Intergenic
924829092 1:247573484-247573506 GAGGGTGAACAGAAGCAGGGTGG - Intronic
924875643 1:248100325-248100347 GAGGAAATACAAAGGGAGTGGGG - Exonic
1062922844 10:1293036-1293058 GAAGAGATGCAGAGGGAGGGAGG + Intronic
1064133809 10:12732911-12732933 GAGGAAACTGAGAAGGAGGGAGG - Intronic
1065070239 10:22015670-22015692 GATGAGAGACAGAAGGTGGGGGG + Intergenic
1065804560 10:29382785-29382807 GAAGATATCAGGAAGGAGGGAGG - Intergenic
1065944576 10:30594955-30594977 GAAGATATCAGGAAGGAGGGAGG + Intergenic
1066252601 10:33649068-33649090 GTGGATATACAGCAGGGGGATGG + Intergenic
1067292883 10:44957432-44957454 GAGGAAAGAGAGAGGGAGGGAGG - Intergenic
1067842025 10:49688640-49688662 GAGGATAGGCAGAAGCAGGAGGG - Intronic
1068092851 10:52454359-52454381 GAGGCTATACTGAGGAAGGGAGG + Intergenic
1068350059 10:55831426-55831448 GAGGTCATGCAGAAGCAGGGTGG - Intergenic
1068598868 10:58934667-58934689 GAGGTTATTCAGATGGAAGGTGG + Intergenic
1068933261 10:62612679-62612701 AAGGAGATGCAGAAGCAGGGGGG + Intronic
1070628568 10:78068221-78068243 GGGGACAGACAGAAGGAGGATGG + Intergenic
1071161648 10:82753528-82753550 GAGGAAAGAAAGAAGGAGGGAGG - Intronic
1071296974 10:84228273-84228295 TGGGAAATACAGAAGGAGGGAGG - Intergenic
1072375767 10:94814079-94814101 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1072389643 10:94969730-94969752 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1073943993 10:108730019-108730041 AGGAATAGACAGAAGGAGGGAGG + Intergenic
1074147716 10:110731210-110731232 GAGGAAATAAGAAAGGAGGGAGG - Intronic
1074532335 10:114305942-114305964 GAGGAGATGCAGATGCAGGGGGG + Intronic
1075166663 10:120074079-120074101 GAGAATATAGGGAAGGAAGGTGG - Intergenic
1075175387 10:120155855-120155877 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1075468988 10:122673671-122673693 GAGGATACAAAGAAAGAAGGTGG - Intergenic
1075600190 10:123761910-123761932 GAGGACTTCCAGAAGGAGGAGGG - Exonic
1076252363 10:128994644-128994666 GAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1076489253 10:130845838-130845860 GAGGATGAACACAAGGAGGGTGG + Intergenic
1077280515 11:1742952-1742974 GAGGATGGACAGATGGAGGATGG + Intronic
1077280591 11:1743354-1743376 GAGGATGGACAGATGGAGGATGG + Intronic
1077655084 11:4010908-4010930 GAGAACATACAGACAGAGGGAGG - Intronic
1077657065 11:4029553-4029575 GAGGAGGGACGGAAGGAGGGTGG + Intronic
1077799584 11:5524748-5524770 GAGGGTAGACAGAAACAGGGAGG - Intronic
1078007148 11:7540506-7540528 GAGAATATAGAGAGGGAGGTGGG + Intronic
1079292436 11:19200477-19200499 AAGGAAAGAGAGAAGGAGGGAGG - Intronic
1079518580 11:21297881-21297903 GATGAGGGACAGAAGGAGGGAGG + Intronic
1079523276 11:21354346-21354368 GAGAGTAGAAAGAAGGAGGGAGG - Intronic
1081252436 11:40851431-40851453 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1081430875 11:42975328-42975350 GAGGAAATACAGCTAGAGGGAGG - Intergenic
1081691826 11:45083520-45083542 GAGGATAGACAGAGGCAGTGGGG + Intergenic
1082914817 11:58421742-58421764 GAGGATATTGACAATGAGGGAGG + Intergenic
1083387076 11:62319085-62319107 GAAGATCCAGAGAAGGAGGGAGG + Intergenic
1084470413 11:69356174-69356196 GAGGATGAAGAGAAGGAAGGAGG + Intronic
1084911913 11:72396277-72396299 GAGAAAAGGCAGAAGGAGGGAGG + Intronic
1085325992 11:75606947-75606969 GAGGACGTAGAGAAGGAAGGAGG - Intronic
1085326604 11:75611132-75611154 AAGGATAGAGGGAAGGAGGGAGG - Intronic
1085452197 11:76641145-76641167 GAGGCTACACTGAAGTAGGGTGG + Intergenic
1086421830 11:86644906-86644928 GAGGGTGAACAGAAGCAGGGTGG + Intronic
1086579619 11:88384386-88384408 GGAGATATTCAGAAGGAAGGAGG - Intergenic
1087171742 11:95056564-95056586 TATGAAATACAGAAAGAGGGCGG + Intergenic
1087205117 11:95386363-95386385 GAGGATAGACTGGAGGAGGCTGG + Intergenic
1088707361 11:112475885-112475907 GAGGGTAGACAGAAGAAGGTGGG - Intergenic
1089628955 11:119771549-119771571 GAGCATCTACACAAGGAGGCAGG + Intergenic
1090145132 11:124313223-124313245 AAGGAAAGAAAGAAGGAGGGAGG + Intergenic
1090472527 11:126992957-126992979 GAGGAGGCACAGAAGGATGGTGG - Intronic
1090570362 11:128038263-128038285 GAGGATGCACAGAATGAGAGGGG - Intergenic
1091907818 12:4203068-4203090 CAGGATCTAGAGAAGGAGGTGGG - Intergenic
1092629031 12:10358826-10358848 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1093294524 12:17371838-17371860 GAGGAAAGAAAGAGGGAGGGAGG - Intergenic
1093772586 12:23034865-23034887 GAGGAAAGGAAGAAGGAGGGAGG - Intergenic
1094088228 12:26617741-26617763 AAGGAAGGACAGAAGGAGGGAGG + Intronic
1094701137 12:32871973-32871995 GGGGAGAGAGAGAAGGAGGGAGG - Intronic
1094800261 12:34024845-34024867 GAGGATACAGAGAAGGAGCAGGG + Intronic
1096313770 12:50545339-50545361 GAAGAAAGAAAGAAGGAGGGAGG - Intronic
1096649800 12:53056661-53056683 GAGACCATACTGAAGGAGGGTGG - Intronic
1098285540 12:68903789-68903811 AAGGAGAGACAGAGGGAGGGAGG - Intronic
1098925083 12:76340641-76340663 GAAGATACAGTGAAGGAGGGAGG + Intergenic
1099107809 12:78518769-78518791 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
1099621504 12:85007518-85007540 GAGGAGAGAGAGAAGGAGTGGGG + Intergenic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1100110967 12:91242411-91242433 GAGGGTATGCCGAAGCAGGGTGG + Intergenic
1100699734 12:97134510-97134532 GAGGTTATGCTGAAGTAGGGTGG + Intergenic
1101021987 12:100562367-100562389 GAGAATATAAAGAAAGAGAGTGG + Intronic
1101580552 12:106037908-106037930 GAGGAGAAAGAGAAGGAGAGAGG - Intergenic
1101917960 12:108910999-108911021 GGGGACATAGACAAGGAGGGAGG - Exonic
1102596457 12:113996508-113996530 GAAGATATTCAGGAGGTGGGGGG - Intergenic
1102622621 12:114208752-114208774 GAAGGAATCCAGAAGGAGGGAGG + Intergenic
1102764793 12:115423208-115423230 GAGGAAAAAGAGGAGGAGGGAGG + Intergenic
1102916999 12:116761523-116761545 GAGGACATGCAGGAGGATGGTGG - Intronic
1102919996 12:116784766-116784788 GTGGAGATATAGAAGGAGGATGG - Intronic
1103245768 12:119455888-119455910 AAGGAAAGAAAGAAGGAGGGAGG + Intronic
1103344782 12:120241964-120241986 GTGGATATGGAGAAGGAGTGAGG + Intronic
1104172519 12:126295900-126295922 AAGGAAAGAGAGAAGGAGGGAGG + Intergenic
1104498552 12:129263623-129263645 GGGCATATAGAGAGGGAGGGAGG + Intronic
1106189593 13:27439559-27439581 GAAGAAAAACAAAAGGAGGGAGG + Intronic
1106415647 13:29543775-29543797 GAGGTTCTACAGGAGGAGGGAGG + Intronic
1106992200 13:35434684-35434706 GAGGATGTAGAGAAGGTGAGTGG + Intronic
1107453107 13:40529810-40529832 AAAGAGATAGAGAAGGAGGGAGG + Intergenic
1107650727 13:42542063-42542085 GAAGATAAAGAGAAGGAGAGAGG - Intergenic
1107810114 13:44192349-44192371 AAGGATATAGAGGAGGAGTGGGG + Intergenic
1110644576 13:77867431-77867453 GAGGATCTACACTAGGAGAGAGG + Intergenic
1110910101 13:80949105-80949127 GAGGAAAGACAGAAAGTGGGTGG + Intergenic
1112111910 13:96310632-96310654 AGGGACATAGAGAAGGAGGGAGG - Intronic
1112584586 13:100707065-100707087 GAGGCTATACTGGATGAGGGCGG - Intergenic
1113155950 13:107322144-107322166 GAGCATATACAAAAGAAGGTTGG - Intronic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1114293026 14:21304328-21304350 GAGGAAAGAAGGAAGGAGGGAGG + Intronic
1114367701 14:22047710-22047732 GAGGAAAGACAGAAGAAAGGAGG - Intergenic
1114467938 14:22937836-22937858 AAGCCTATAGAGAAGGAGGGAGG - Intergenic
1114546911 14:23509732-23509754 GAGGCTTTAGAGAGGGAGGGAGG + Intronic
1116675297 14:47898862-47898884 GAGGTCATACTGAAGTAGGGTGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117624134 14:57618382-57618404 GAGGGTAAGCAGAAGCAGGGTGG + Intronic
1118512374 14:66489623-66489645 GAGAAGATACAGGAGGAGGCAGG - Intergenic
1118657172 14:67965168-67965190 GAGGATATAGGAAGGGAGGGAGG - Intronic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1119113153 14:71994623-71994645 GAGGTCATACAAAAGTAGGGTGG + Intronic
1119345022 14:73916137-73916159 GGAGAGATAGAGAAGGAGGGCGG + Intronic
1119615420 14:76095804-76095826 AAGGACAGACAGTAGGAGGGTGG - Intergenic
1120624964 14:86813768-86813790 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1120913329 14:89687802-89687824 AAGTAGATACAGATGGAGGGGGG + Intergenic
1121439891 14:93941973-93941995 GAGGTTGGACAGAAGGTGGGTGG + Intronic
1121777175 14:96598436-96598458 GAGGAGGTAGAGAAGGAGGTGGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1121896725 14:97655595-97655617 GAGAATATTCGGAGGGAGGGGGG + Intergenic
1122419069 14:101564089-101564111 GAGGAGGGACAGGAGGAGGGGGG - Intergenic
1122578491 14:102756515-102756537 GAAGAAATAAGGAAGGAGGGAGG - Intergenic
1125233210 15:37482043-37482065 GAGGAGAGAGGGAAGGAGGGAGG + Intergenic
1125517710 15:40332001-40332023 GAGGGCACACAGGAGGAGGGAGG - Intronic
1125720269 15:41841991-41842013 GAGGAGGTGCAGAGGGAGGGAGG - Intronic
1126577299 15:50209685-50209707 GAGAATACACAGAAGGATGAAGG + Intronic
1126824584 15:52536497-52536519 GAGAATATGCAGGAGGAGGTGGG - Intergenic
1127218911 15:56856377-56856399 GAGAATATTCAGAAGGAGTGAGG - Intronic
1127223211 15:56902106-56902128 GAAGGAATAAAGAAGGAGGGAGG + Intronic
1127764613 15:62172926-62172948 GAGGTCATACTGAAGTAGGGTGG - Intergenic
1127788661 15:62378822-62378844 GAGGAAATATTGAAGAAGGGAGG + Intergenic
1128037885 15:64542746-64542768 GGGGATGGAGAGAAGGAGGGTGG - Intronic
1128519174 15:68364428-68364450 GTGCATATCCCGAAGGAGGGAGG - Intronic
1128896415 15:71377599-71377621 GAGGATAAGGAGAAAGAGGGCGG + Intronic
1129889050 15:79059069-79059091 GAAGAGGGACAGAAGGAGGGAGG - Intronic
1130638955 15:85652908-85652930 GAGGTTATACTGGAGTAGGGTGG - Intronic
1131833303 15:96367832-96367854 GAGAAAATTCAGAAGGAAGGGGG + Intergenic
1132261572 15:100429693-100429715 GAGGATCAACTGAAGGATGGGGG - Intronic
1134106162 16:11487037-11487059 GTGGATAGATGGAAGGAGGGAGG + Intronic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1135263908 16:21005206-21005228 AAGGAAATACAGAAGGAGAGAGG - Intronic
1135637934 16:24094938-24094960 AAGGAGGGACAGAAGGAGGGAGG + Intronic
1136043046 16:27595429-27595451 GAGGATATACAGGAGTGTGGGGG + Intronic
1137631332 16:49947895-49947917 GAGGATATACTGGAGTAGGATGG + Intergenic
1138130622 16:54476602-54476624 GAGGGGAGACAGAGGGAGGGGGG + Intergenic
1138814357 16:60187077-60187099 GAGGTTATAGAGAAGGACTGAGG - Intergenic
1139531341 16:67544139-67544161 GAGGATTTCCAGAAGGAGGAAGG - Intronic
1140119123 16:72068163-72068185 GAGGATATAGAGAAAGAAGCTGG + Intronic
1140735984 16:77898207-77898229 GAGATTATACTGAAGTAGGGTGG - Intronic
1140832803 16:78767073-78767095 AAGGAGAGAGAGAAGGAGGGAGG - Intronic
1140914711 16:79483189-79483211 AAGGAGGGACAGAAGGAGGGAGG - Intergenic
1141225814 16:82113881-82113903 GAGGGCATACAGGAGTAGGGTGG - Intergenic
1141884138 16:86880238-86880260 GAGGAAAAAGAGAAGAAGGGAGG + Intergenic
1142254330 16:89006715-89006737 GAGGAGATGGAGGAGGAGGGAGG - Intergenic
1142254355 16:89006776-89006798 GAGGAGATGGAGGAGGAGGGAGG - Intergenic
1142254368 16:89006806-89006828 GAGGAGATAGAGGGGGAGGGAGG - Intergenic
1142280921 16:89147167-89147189 GAGGGTCCACAGAGGGAGGGAGG + Intronic
1143549567 17:7621731-7621753 GAGAAATTACAGAAGGAGGCTGG + Intronic
1144453300 17:15398950-15398972 GAGGATACAGAAAAGGAGGGTGG - Intergenic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1146802117 17:35833283-35833305 GTGGGTATAGAGTAGGAGGGCGG + Intronic
1147163220 17:38579593-38579615 GAGGAGAGACTGAAGAAGGGAGG - Intronic
1147950626 17:44105743-44105765 GGGCCTATACAGGAGGAGGGAGG - Intronic
1148716648 17:49720532-49720554 GAAGATATATACAAGGAGGATGG + Intronic
1148798952 17:50211098-50211120 GAGGAGGGAGAGAAGGAGGGGGG - Intergenic
1149268545 17:54953394-54953416 CAGGTTACACAGAAGAAGGGGGG - Intronic
1149934198 17:60787639-60787661 AAGGAGATAGAGTAGGAGGGAGG + Intronic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1151234167 17:72706640-72706662 GAAGAAAAACAGAAGCAGGGTGG - Intronic
1151776500 17:76207056-76207078 GTGTATATACAGAAAGATGGTGG - Intronic
1152297513 17:79476722-79476744 GAGGATAGGCAGAGGCAGGGTGG + Intronic
1153498938 18:5728826-5728848 CAGGAGGTACAGAAGGAGGTCGG - Intergenic
1153904313 18:9647587-9647609 GAGGAGATAGAGATGAAGGGAGG - Intergenic
1155449308 18:25946791-25946813 GAGGAAAGAAGGAAGGAGGGAGG + Intergenic
1155858952 18:30872087-30872109 GAGAAGAGACAGAGGGAGGGGGG - Intergenic
1156540728 18:37907259-37907281 GAGAATATACAGAACGATTGTGG - Intergenic
1156636680 18:39039315-39039337 AAGGAAGGACAGAAGGAGGGAGG + Intergenic
1157081644 18:44531950-44531972 GAAGTCATACAGAAGTAGGGTGG + Intergenic
1157595854 18:48863131-48863153 CAGGACATACCGACGGAGGGAGG - Intronic
1157776607 18:50401362-50401384 GAAGAGATAAAGAAAGAGGGAGG - Intergenic
1158419745 18:57282610-57282632 GAGAATATACAGAAGAGGAGAGG - Intergenic
1158500404 18:57995744-57995766 GAGGAAGGACAGGAGGAGGGAGG + Intergenic
1158661150 18:59388837-59388859 GAGGTTAAACAGAAAGAGTGTGG + Intergenic
1158825877 18:61218480-61218502 GAGGCCATACGGAAGTAGGGTGG + Intergenic
1158963954 18:62607639-62607661 GAGGTTATACTGGAGTAGGGTGG - Intergenic
1159116490 18:64119245-64119267 GAGGAAGAACAGAAGGAAGGAGG + Intergenic
1159274225 18:66194278-66194300 GCAGATCTACAGAAGGAGGGTGG - Intergenic
1159913898 18:74172078-74172100 GAGGAAACAGAGGAGGAGGGGGG - Intergenic
1160017748 18:75157457-75157479 GAGGTCATACTGGAGGAGGGTGG + Intergenic
1160709619 19:544993-545015 GTGGATACATGGAAGGAGGGAGG - Intronic
1161256000 19:3310063-3310085 GAGGAGAGAGAGATGGAGGGAGG - Intergenic
1161287677 19:3477303-3477325 GATGATAGACAGATGGTGGGTGG + Intronic
1161381692 19:3968866-3968888 GAGGCTCTACAAAAGGAGGCAGG + Intronic
1161571730 19:5034566-5034588 AAGGCTATACAGAAGCAGGAAGG + Intronic
1161665693 19:5574846-5574868 GAGGAAGGAAAGAAGGAGGGAGG + Intergenic
1161847265 19:6718964-6718986 GAGGAGATTCAGAAGGGGTGGGG + Intronic
1161868209 19:6850336-6850358 TAGGATATAAAGGAAGAGGGAGG - Intronic
1162105583 19:8367679-8367701 GAGGAAAGAAAGAGGGAGGGAGG - Intronic
1162501992 19:11059465-11059487 GAGATTGTGCAGAAGGAGGGAGG + Intronic
1163093040 19:15034660-15034682 GAGGATATACAGAAAAAGAGGGG - Intergenic
1163144859 19:15373391-15373413 GAGGTTATACTGAGGGAGTGTGG - Intronic
1163178288 19:15581079-15581101 GAAGAAAGAGAGAAGGAGGGAGG - Intergenic
1163178293 19:15581102-15581124 GAAGAAAGAGAGAAGGAGGGAGG - Intergenic
1163178298 19:15581125-15581147 GAAGAAAGAGAGAAGGAGGGAGG - Intergenic
1163178303 19:15581148-15581170 GAAGAAAGAGAGAAGGAGGGAGG - Intergenic
1163178308 19:15581171-15581193 GAAGAAAGAGAGAAGGAGGGAGG - Intergenic
1163178313 19:15581194-15581216 GAAGAAAGAGAGAAGGAGGGAGG - Intergenic
1163178318 19:15581217-15581239 GAAGAAAGAGAGAAGGAGGGAGG - Intergenic
1163178323 19:15581240-15581262 GAAGAAAGAGAGAAGGAGGGAGG - Intergenic
1163178328 19:15581263-15581285 GAAGAAAGAGAGAAGGAGGGAGG - Intergenic
1163178333 19:15581286-15581308 GAAGAAAGAGAGAAGGAGGGAGG - Intergenic
1163178338 19:15581309-15581331 GAAGAAAGAGAGAAGGAGGGAGG - Intergenic
1164250274 19:23469629-23469651 GAGGAGATGGAGAAGGAGGGGGG - Intergenic
1164441814 19:28284865-28284887 GAGGGTGGAGAGAAGGAGGGTGG + Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164937087 19:32223404-32223426 AAGGATAGAGGGAAGGAGGGAGG + Intergenic
1165068589 19:33242341-33242363 GTGGATGCACAGCAGGAGGGTGG - Intergenic
1165084926 19:33337911-33337933 GAGGAAAGAGAGAAGGAGGCCGG + Intergenic
1165253785 19:34560316-34560338 GAAGAGATAGAGAAAGAGGGAGG + Intergenic
1165426802 19:35750357-35750379 GAGGAGAGACAGAGTGAGGGTGG - Intronic
1165796585 19:38523475-38523497 GAGAAGATACAGGAGGAGGAAGG - Intronic
1165796601 19:38523551-38523573 GAGAAGATACAGGAGGAGGAAGG - Intronic
1166317343 19:41996554-41996576 GAGGCTCTGCAGAAGTAGGGGGG + Intronic
1166519506 19:43471072-43471094 GAGGTTACACAGCAAGAGGGTGG - Intergenic
1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG + Intronic
1167153943 19:47726642-47726664 GAGGATGTAAGGAAGGAGGAAGG - Intronic
1167619225 19:50551870-50551892 AAGGAGAGAAAGAAGGAGGGAGG - Intronic
1168335556 19:55595497-55595519 TAGGCTTTAAAGAAGGAGGGTGG - Intronic
925140248 2:1545102-1545124 GAGGATATTCAGTAGGAGAATGG - Intergenic
925574827 2:5349722-5349744 GAGGCCATAGAGATGGAGGGGGG + Intergenic
926039436 2:9660970-9660992 GAGGGAATACAGAATGGGGGAGG - Intergenic
926475461 2:13315488-13315510 GATAAAATACAGAAGGAAGGGGG - Intergenic
926714509 2:15913573-15913595 GAGGCTAGGCAGAGGGAGGGAGG + Intergenic
926888571 2:17619724-17619746 GAGGAAATGCATAAGGAGGGAGG - Intronic
927773078 2:25880491-25880513 AAGGAAATCCAGAAGGAGGGTGG - Intergenic
928154058 2:28859598-28859620 GAGGGAATAGAGAAGGAGAGGGG - Intronic
928472477 2:31588164-31588186 GAGGACATAGAGAAAGAGAGAGG + Intergenic
928838919 2:35581611-35581633 GTGTATACACAAAAGGAGGGGGG + Intergenic
928963664 2:36955560-36955582 GAGAAGAGACAGAAGAAGGGAGG - Intronic
929107290 2:38377359-38377381 GAGGAGATACAGGCGGAGAGCGG - Intergenic
930331458 2:49990337-49990359 GAGGAAAGACAAAAGGAAGGAGG + Intronic
930831804 2:55752082-55752104 GAGGACATACTGGAGTAGGGTGG + Intergenic
931206358 2:60149381-60149403 GAGGATGGAATGAAGGAGGGTGG - Intergenic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
933148963 2:78891346-78891368 AAGGAGAGACAGAAGGAAGGAGG - Intergenic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
934150121 2:89138434-89138456 GAGGATAGACAGAGTGAGGCTGG - Intergenic
934217175 2:90043595-90043617 GAGGATAGACAGAGTGAGGCTGG + Intergenic
935785168 2:106542137-106542159 GAGGATCTACAGAGGAGGGGAGG - Intergenic
937160857 2:119759858-119759880 GAGGAGGTGGAGAAGGAGGGGGG + Exonic
937321869 2:120965803-120965825 GAGGACAGAAAGAAGCAGGGAGG - Intronic
937998868 2:127716100-127716122 GAGGCTATACAGAAGGAACGTGG - Intronic
940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG + Intergenic
941282283 2:163567922-163567944 AAGGAGAGAGAGAAGGAGGGAGG + Intergenic
941339335 2:164287060-164287082 GAGGAAGGAAAGAAGGAGGGAGG + Intergenic
943575933 2:189631076-189631098 GAGGAAAAACAAAAGGAAGGAGG + Intergenic
945482287 2:210357986-210358008 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
945965751 2:216184881-216184903 CAGGGCATACAGAAGAAGGGAGG - Intronic
946316741 2:218920837-218920859 GAAGAAAGAAAGAAGGAGGGAGG - Intergenic
946394565 2:219436635-219436657 GAGGAGATGCCGATGGAGGGAGG - Intronic
946702792 2:222429291-222429313 TAGTATATTCAGTAGGAGGGTGG + Intronic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
948269721 2:236664968-236664990 GGGGTTCTACAGCAGGAGGGAGG + Intergenic
948302140 2:236915508-236915530 CAGGAAATTCAGAAGGAGGTTGG - Intergenic
948561099 2:238853360-238853382 GAGGATATAGCAGAGGAGGGAGG + Intronic
948677632 2:239608139-239608161 GAGGAGAGACAGAGAGAGGGAGG - Intergenic
1168938711 20:1690759-1690781 GAGGGTAAGCAGAAGCAGGGTGG + Intergenic
1169348251 20:4846965-4846987 GAGGATGGGCAGAAGGAGAGGGG + Intergenic
1169505789 20:6209540-6209562 GAGGAAAGAAAGAGGGAGGGAGG - Intergenic
1170536545 20:17346404-17346426 GAGGAGGAACAGAAGGATGGTGG - Intronic
1170919111 20:20659475-20659497 TAGGATATATTGAAGAAGGGAGG - Intronic
1171186893 20:23129187-23129209 GAGGATAGAGAAATGGAGGGAGG + Intergenic
1171823017 20:29872890-29872912 GAAGATATAGAGAAAGAGGCAGG + Intergenic
1171956010 20:31464364-31464386 GAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1172591296 20:36119901-36119923 GAGGGTACAGAGGAGGAGGGCGG - Intronic
1172773333 20:37393870-37393892 GAGCAGGGACAGAAGGAGGGAGG - Intronic
1172974463 20:38895790-38895812 GAGGAGAGAAAGAAGGAAGGAGG - Intronic
1172974469 20:38895817-38895839 GAGGAGAGAAAGAAGGAAGGAGG - Intronic
1172974514 20:38895979-38896001 GAGGAGAGAAAGAAGGAAGGAGG - Intronic
1172974521 20:38896007-38896029 GAGGAAAGAAAGAAGGAAGGGGG - Intronic
1173034338 20:39394359-39394381 GAAGATATGCAGGAGGAGGAGGG + Intergenic
1173186008 20:40840801-40840823 AAGGAAAAACAGAAGGAAGGAGG + Intergenic
1173190305 20:40870890-40870912 GAGGTTATACAGAAGTAGGTTGG - Intergenic
1175432445 20:58915599-58915621 GAGGAAGGAGAGAAGGAGGGAGG - Intergenic
1176914433 21:14608242-14608264 CAGGAGATAGAGGAGGAGGGTGG - Intronic
1177323836 21:19557327-19557349 GACGATATTCAGGGGGAGGGTGG + Intergenic
1177352882 21:19967699-19967721 GAGGTCATACTGAAGTAGGGTGG + Intergenic
1177543947 21:22532711-22532733 GAGGTTATACAGAAGTAGTGTGG + Intergenic
1178259472 21:31085571-31085593 AGGGATAGACAGAGGGAGGGAGG + Intergenic
1178378240 21:32086114-32086136 GAGGATAAACAGCAGGTGGGAGG - Intergenic
1178864534 21:36316971-36316993 GAGGGTGAACAGAAGCAGGGTGG - Intergenic
1178925273 21:36769531-36769553 GAAAATATACAGAAGCAGGGAGG - Intronic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1180609576 22:17086328-17086350 GAGGATTTACCGAAAGAAGGTGG + Intronic
1181016048 22:20069505-20069527 GAGGAAGGAAAGAAGGAGGGAGG + Intergenic
1181161755 22:20963941-20963963 GAGGAGATTCTGAAGGTGGGTGG + Intergenic
1181884597 22:26010254-26010276 GAGGATGGACTAAAGGAGGGTGG - Intronic
1183296882 22:37035060-37035082 GAGGATTCAGAGAAGGAGGCAGG - Intergenic
1184449800 22:44576099-44576121 GAGGAGGTAGAGGAGGAGGGAGG + Intergenic
1185006820 22:48282870-48282892 GAGGGAAAAAAGAAGGAGGGAGG + Intergenic
949093682 3:60629-60651 GAAGATAGACAGAAGAAGAGTGG + Intergenic
949525574 3:4900172-4900194 GAGTGTATACAGAGGGAGAGAGG - Intergenic
949867748 3:8560377-8560399 GATGATACACTGAAGGAAGGAGG - Intronic
950704505 3:14771594-14771616 GAGGCCATACTGGAGGAGGGTGG - Intronic
951676521 3:25247616-25247638 GAGGATGAGCAGAAGCAGGGTGG - Intronic
951832085 3:26942470-26942492 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
951943118 3:28104029-28104051 GAGGATAGACAGAACGGTGGGGG - Intergenic
952006519 3:28847757-28847779 AAGCATATACAGAAGTAGGTTGG - Intergenic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
952846957 3:37695900-37695922 GAGGAAAGACAGAAGGAATGGGG - Intronic
953102438 3:39842755-39842777 GAGGGCAGACAGAAGCAGGGGGG - Intronic
953432262 3:42850029-42850051 AAGGATGTACAAAAGGGGGGAGG + Intronic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
955375063 3:58387792-58387814 GAGGAGAGAAAGAAGGAGAGAGG + Intronic
955445093 3:59001401-59001423 GAGGAGAGAGAGAAGGAGAGAGG - Intronic
955603541 3:60673993-60674015 GAGGATAGAGAGAATGAGGGAGG - Intronic
957119204 3:76068039-76068061 GAAGAAATACACATGGAGGGTGG + Intronic
957695650 3:83635644-83635666 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
957813170 3:85254858-85254880 GGAGAGAGACAGAAGGAGGGAGG - Intronic
958706861 3:97666645-97666667 GAGGTCATACTGAAGTAGGGTGG - Intronic
958849940 3:99312468-99312490 GAGGATATAGGGAGGGAGGAGGG + Intergenic
959758564 3:109928845-109928867 GAAGAGAGAGAGAAGGAGGGAGG + Intergenic
960441387 3:117693211-117693233 GAGGATCTAAAGCAGAAGGGAGG - Intergenic
962313410 3:134342020-134342042 GAGGTCATACAGGATGAGGGTGG + Intergenic
962765633 3:138560207-138560229 GAGGGCAAACCGAAGGAGGGTGG + Intronic
963550084 3:146709334-146709356 GAGGAAGGAAAGAAGGAGGGAGG - Intergenic
963772846 3:149406527-149406549 GAGGAGAGAGAGAGGGAGGGAGG + Intergenic
963863613 3:150336179-150336201 GAGGATATACAGAAGGAGGTGGG - Intergenic
964277132 3:155020709-155020731 GAAGAGATAGAGAAGGAGGGAGG + Intergenic
964738597 3:159942141-159942163 AAGGAGAGAGAGAAGGAGGGAGG + Intergenic
964904752 3:161706934-161706956 GAGGGTGGACAGAAGCAGGGTGG + Intergenic
965640984 3:170828813-170828835 GAGAAGAAACAGAGGGAGGGAGG + Intronic
966079237 3:175978653-175978675 GAGGACATACAGGAGGACCGCGG - Intergenic
966308953 3:178572148-178572170 CAGCATATACAAAAGAAGGGTGG + Intronic
966585118 3:181615149-181615171 GAGGAAACAAAAAAGGAGGGAGG + Intergenic
967656864 3:192060890-192060912 GAGGAAATACAGGAGAAGGAAGG + Intergenic
967764349 3:193261955-193261977 GAGGACAGACAGAAGGATAGTGG + Intronic
967893770 3:194381761-194381783 GCAGAGATTCAGAAGGAGGGCGG + Intergenic
968276958 3:197447274-197447296 GAGGAAATGCTGAGGGAGGGAGG - Intergenic
968957336 4:3726036-3726058 GAGGAGAGAGAGAGGGAGGGAGG + Intergenic
969239904 4:5891091-5891113 GGGGAGATACAGAAGGGGTGGGG + Intronic
970159343 4:13173308-13173330 GAGGAAAGAAGGAAGGAGGGAGG + Intergenic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
970541739 4:17087096-17087118 GAGCATATACATAAGGGGTGTGG + Intergenic
970828097 4:20302627-20302649 GGGGATATATTTAAGGAGGGAGG + Intronic
971061479 4:22976842-22976864 TAGAATATACAGGAGGAGGAAGG + Intergenic
971394283 4:26214302-26214324 AAGGAGACAGAGAAGGAGGGAGG + Intronic
971414861 4:26415484-26415506 TAAGATATACACAAGGAGGTGGG - Exonic
972388468 4:38590273-38590295 GAGGATGTAAGGAAGGAGGGAGG - Intergenic
972648726 4:40994855-40994877 AAGGAGAGAGAGAAGGAGGGAGG + Intronic
972856704 4:43115572-43115594 GAGGAGATAGAGAAAGAGAGAGG + Intergenic
973284227 4:48397366-48397388 AAGGAAATACAGAAGGAAAGAGG + Intronic
973614664 4:52666353-52666375 GAGGAAAAAGGGAAGGAGGGAGG + Intergenic
974833984 4:67224566-67224588 GTGAATATAAAGAAGGAGAGTGG + Intergenic
975318168 4:72978995-72979017 GAGGATATACTGAAGTAGGGTGG + Intergenic
976582112 4:86749259-86749281 GAGGAGACAGAGGAGGAGGGAGG - Intronic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977531570 4:98206791-98206813 GAGAAGAGACAGAATGAGGGAGG + Intergenic
978112594 4:104980109-104980131 GAGGATATAGAGAAAGAGACAGG + Intergenic
979085433 4:116404287-116404309 TAGGGAATACAGAAGGAGAGAGG + Intergenic
980148679 4:129021099-129021121 GAGGATGAACAGAAGTAGGGTGG + Intronic
980620697 4:135299084-135299106 GAGGATGTTTATAAGGAGGGAGG - Intergenic
980674216 4:136053539-136053561 TAGGATATACAGAAGTAGGTGGG + Intergenic
980945997 4:139320945-139320967 GAGGATAAAAAGAAGGTGGCTGG - Intronic
981131502 4:141162651-141162673 GAGGACAAGCAGAAGCAGGGTGG + Intronic
981254382 4:142644238-142644260 GAGGAGAAAGAGAAGGAAGGGGG + Intronic
981358880 4:143824576-143824598 GAGATTATACAGGAGTAGGGTGG - Intergenic
981379401 4:144055401-144055423 GAGATTATACAGGAGTAGGGTGG - Intergenic
981775938 4:148367961-148367983 GAGGAAATACAGCAGGAGGGCGG - Intronic
982010631 4:151102629-151102651 GAGGGTAGAAAGGAGGAGGGAGG + Intronic
982149272 4:152434653-152434675 AAGGATATACAGAAGGGAGAGGG + Intronic
984255411 4:177384384-177384406 GAGGATAAACAGAACTAAGGAGG + Intergenic
984340631 4:178452003-178452025 GATGATACACAGAAGAGGGGAGG + Intergenic
984678559 4:182579089-182579111 GTGGAGATACAGAAGAAGGCAGG - Intronic
984803338 4:183734025-183734047 GAGGAAATAAGGAGGGAGGGAGG - Intergenic
984951375 4:185010218-185010240 GAGGAGATATGGGAGGAGGGTGG + Intergenic
986313369 5:6571118-6571140 GAGGAAGGAGAGAAGGAGGGAGG + Intergenic
986313440 5:6571324-6571346 GAGGAAGGAGAGAAGGAGGGAGG + Intergenic
986313461 5:6571390-6571412 GAGGAAGGAGAGAAGGAGGGAGG + Intergenic
986440957 5:7781386-7781408 GAGGTCATGCTGAAGGAGGGTGG + Intronic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
986936884 5:12900128-12900150 GAGGATGGAGAGAGGGAGGGAGG + Intergenic
988187952 5:27890810-27890832 CAGGAGAGAGAGAAGGAGGGGGG - Intergenic
988970712 5:36465105-36465127 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
989208184 5:38832073-38832095 GAGGAGAGAGAGAAGGAGAGAGG - Intergenic
989208190 5:38832169-38832191 GAGGAGAGAGAGAAGGAGAGAGG - Intergenic
989647799 5:43654962-43654984 TAGGTGATACAGAAGGAGTGGGG - Intronic
990755424 5:59064108-59064130 AAGGAAAGAGAGAAGGAGGGAGG + Intronic
991034496 5:62114593-62114615 GAGGCTAAACAGAAGGAATGTGG - Intergenic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991974782 5:72175048-72175070 GAGGAAAGATAGAAGGAAGGAGG - Intronic
992371059 5:76144632-76144654 GAGGAGATACAAAAGGAGAAGGG + Intronic
992381143 5:76239087-76239109 CAGGACATACAGAAGTGGGGGGG - Intronic
993407526 5:87529882-87529904 AAGGAGAGAGAGAAGGAGGGAGG - Intergenic
993682737 5:90899639-90899661 TAGGATACAAAGAACGAGGGTGG - Intronic
994226391 5:97255764-97255786 GAGTATATAGAGAAGGAGATGGG + Intergenic
994498808 5:100547712-100547734 GATGATATACAGTAGCAGTGTGG + Intronic
995067742 5:107880948-107880970 GTGGAGATAGAGAAGGAGAGAGG + Intronic
995115147 5:108471001-108471023 GAGGATCTCCAGAAGGATTGAGG + Intergenic
995474955 5:112538796-112538818 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
995739706 5:115342854-115342876 GTGGATATGCAGAAGGAGTGGGG + Intergenic
996118211 5:119642547-119642569 GAGGAGAGGCAGAAGGATGGAGG - Intergenic
996426701 5:123320609-123320631 GAGGATGAGCAGAAGAAGGGTGG - Intergenic
997347571 5:133203053-133203075 GAGCATATGCAGAAGGCAGGAGG - Intronic
998855420 5:146390312-146390334 GAGGATGTTCAGAAGGGGAGGGG - Intergenic
999030160 5:148281580-148281602 GAGGGTAAACAGAAGCAGAGTGG - Intronic
1000063789 5:157678210-157678232 GAGGAATTAAAGAGGGAGGGTGG - Intronic
1000173415 5:158726702-158726724 GAGAATCTACATAAGGATGGGGG + Intronic
1000918949 5:167116164-167116186 AAGGATAAACAGAAGGAAGTAGG + Intergenic
1001200647 5:169713124-169713146 GAGGCTGTACAGAAGAAAGGGGG - Intronic
1001241944 5:170077891-170077913 GAGAAGAGAGAGAAGGAGGGGGG - Intronic
1002058283 5:176610741-176610763 GAGGGTATCCAGGGGGAGGGGGG - Intergenic
1003637519 6:7846510-7846532 GGGGAAACACAGAAGGAGGAAGG + Intronic
1003941886 6:11036944-11036966 GAGGAGAGAGAGAAGGAGAGGGG + Intronic
1004220359 6:13741736-13741758 GAGGTCATACTGAAGCAGGGAGG - Intergenic
1005018257 6:21394008-21394030 GAAGAAATACTGAAGAAGGGAGG - Intergenic
1005120096 6:22380120-22380142 GGGGATACAGAGAAGGAGGAGGG - Intergenic
1005223315 6:23613344-23613366 GAAGATATACAGAGGGAGCCAGG + Intergenic
1005624608 6:27651618-27651640 GCGGAGACAGAGAAGGAGGGAGG + Intergenic
1006370173 6:33639426-33639448 GAGGAGGTACAGAAGGAGCACGG + Intronic
1007339434 6:41181153-41181175 GAGGATGGAGAGAAGAAGGGTGG - Intergenic
1008057422 6:46959712-46959734 GAGGAAAGAAAGAGGGAGGGAGG + Intergenic
1008372064 6:50744189-50744211 GAGGGTAAAAAGTAGGAGGGTGG - Intronic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1009023516 6:57970685-57970707 AATTCTATACAGAAGGAGGGTGG + Intergenic
1009199088 6:60722250-60722272 AATTCTATACAGAAGGAGGGTGG + Intergenic
1009295630 6:61942958-61942980 GAGGAGAGAGAGAGGGAGGGAGG + Intronic
1009482904 6:64182841-64182863 GAGGGTAGACAGGAGTAGGGTGG - Intronic
1009545786 6:65018483-65018505 GAGGATATACTGGAGTAGGTGGG - Intronic
1010704290 6:79089600-79089622 AAGGAAAGAAAGAAGGAGGGAGG - Intergenic
1011020784 6:82809787-82809809 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1011980850 6:93376004-93376026 GAAGATAGTCAGAAGGAGGTGGG + Intronic
1012083159 6:94785735-94785757 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1012213215 6:96550329-96550351 GAGGAGGTAGAGAAGGTGGGAGG - Intronic
1012351821 6:98260822-98260844 GGGCATATGCAGAAGGAGAGAGG + Intergenic
1012445456 6:99302729-99302751 GAGGCCATACAGCAGGAGGTAGG + Intronic
1012469355 6:99553594-99553616 GAAGATTTACTGAAGGAGGAAGG - Intronic
1012961902 6:105630967-105630989 GAGGAGATAAAGAAGGAGGGAGG + Intergenic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013423401 6:109987385-109987407 GAGTATAGACAGGAGGAGGTGGG + Intergenic
1013847895 6:114476731-114476753 GAGGAAGTAAAGAAGGAGGGAGG - Intergenic
1014561883 6:122901011-122901033 GAGGAAGTAAAGAAGGAGGGAGG - Intergenic
1014942300 6:127456950-127456972 GAGGAGAAAGGGAAGGAGGGAGG - Intronic
1015163960 6:130182612-130182634 GAGGGAAGAAAGAAGGAGGGAGG + Intronic
1015452036 6:133381010-133381032 GAGGAGGTAGAGAAGGAGGAGGG - Intronic
1017041134 6:150309327-150309349 AAGGAAAGACAGAAGGAAGGAGG + Intergenic
1017132219 6:151117457-151117479 GAGCAGATTCAGAAGGAGTGAGG + Intergenic
1018410573 6:163542241-163542263 GAGGATTAACGGAAGGAGGAAGG - Intronic
1018492117 6:164304529-164304551 TAGGACATAGAGAAAGAGGGAGG - Intergenic
1018949377 6:168369232-168369254 CAGTACATACAGAAGGAGGGAGG - Intergenic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1019132835 6:169890116-169890138 GAGGATTTACAGCAGGCGGCTGG - Intergenic
1019549258 7:1594055-1594077 GAGGATAGATGGAGGGAGGGAGG - Intergenic
1019730654 7:2627628-2627650 GAGGGAGGACAGAAGGAGGGAGG + Intergenic
1019972114 7:4549634-4549656 GAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1020339071 7:7089572-7089594 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1021044780 7:15909150-15909172 GAAGTTATACAGAAGGGGGCAGG - Intergenic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1022714901 7:32891086-32891108 GGGGGAATACAGAAGGAAGGGGG + Intronic
1023456874 7:40349056-40349078 GAGGATATACAGAAGGAGGGTGG - Intronic
1024409038 7:49017379-49017401 GAGCATATATATAAGGGGGGAGG + Intergenic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026494091 7:70887941-70887963 GAAGAGAGAGAGAAGGAGGGTGG + Intergenic
1028645504 7:93092307-93092329 GAGGATATAGAGAAAGAGATTGG - Intergenic
1029144982 7:98439349-98439371 AAAGAAAGACAGAAGGAGGGAGG - Intergenic
1029348624 7:99997206-99997228 GAGGAAGGACAGAGGGAGGGAGG - Intergenic
1029884668 7:103855851-103855873 GAGGTTATACTGGAGTAGGGTGG - Intronic
1030500898 7:110357078-110357100 GAGGATGAACAAAAGCAGGGTGG - Intergenic
1031258299 7:119484192-119484214 GAGGTTATATGGAAGTAGGGTGG + Intergenic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1032320217 7:130879481-130879503 TAGCATATACAGAAGGATGCAGG - Intergenic
1032449090 7:132013109-132013131 AAGGATACAGAAAAGGAGGGAGG - Intergenic
1032724686 7:134580003-134580025 GAGGAAATAGAGATGCAGGGAGG + Intergenic
1032934280 7:136711176-136711198 GGGGAGAGACAGAGGGAGGGAGG + Intergenic
1033227415 7:139572856-139572878 GAGGAGGGAGAGAAGGAGGGAGG - Exonic
1033398318 7:140996593-140996615 TAGGAGAGACAGAAGGATGGAGG - Intergenic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033583329 7:142755819-142755841 GAGGGAAGAGAGAAGGAGGGTGG - Intronic
1033586340 7:142777327-142777349 GAGGGAAGAGAGAAGGAGGGTGG - Intergenic
1033604835 7:142919276-142919298 GTGGATAAAAAGTAGGAGGGAGG - Intronic
1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG + Intergenic
1035998403 8:4574419-4574441 GAGGGTAAGCAGAAGAAGGGTGG - Intronic
1036188836 8:6650833-6650855 GAGGAGAGAGAGAAGGAAGGAGG - Intergenic
1036188839 8:6650852-6650874 GAGAAGAGACAGAAGGAAGGAGG - Intergenic
1036773617 8:11595102-11595124 GAATATATACTGCAGGAGGGGGG - Intergenic
1037540477 8:19865745-19865767 GAGGAAAGAAAGAGGGAGGGAGG + Intergenic
1038898298 8:31812587-31812609 GAGGAGATAAAAAAGGAAGGAGG - Intronic
1038953628 8:32444078-32444100 GAGGAAAGAGAGAGGGAGGGAGG - Intronic
1039282892 8:36006258-36006280 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
1040924261 8:52660240-52660262 GAGGCTGTAAAGGAGGAGGGAGG + Intronic
1041135875 8:54758431-54758453 AAGGATGTATTGAAGGAGGGAGG + Intergenic
1041154969 8:54976733-54976755 GAGGACAAGCAGAAGCAGGGAGG + Intergenic
1041315529 8:56558108-56558130 AAGGAGATAGAGCAGGAGGGCGG - Intergenic
1041525337 8:58799341-58799363 GAGGAGAGACAGAAAGAGAGAGG + Intergenic
1041866670 8:62582084-62582106 AAGGAAAGACAGAAGGAGGGAGG - Intronic
1042082374 8:65069679-65069701 GAGGAGATAGAGAAAGAGGTAGG - Intergenic
1042478731 8:69280045-69280067 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1043020693 8:74996450-74996472 GAGGTGATAGAGAATGAGGGAGG + Intronic
1044122115 8:88410841-88410863 GAGGAAACACAGAAGGTGGATGG + Intergenic
1044312458 8:90709335-90709357 GAGGATGAACAGAAGCAGAGTGG - Intronic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1045325757 8:101116564-101116586 GAGGAGATAGCAAAGGAGGGAGG + Intergenic
1045783189 8:105891871-105891893 GAAGATATGAAGAAAGAGGGAGG + Intergenic
1046092951 8:109524828-109524850 AAGGAAGGACAGAAGGAGGGAGG - Intronic
1048053875 8:130845853-130845875 AAGGATAGAAAGAAGAAGGGAGG + Intronic
1048188682 8:132267864-132267886 GAGGATATTGAGAATGGGGGAGG - Intronic
1048267822 8:133003216-133003238 AAGGAAATAAGGAAGGAGGGAGG + Intronic
1048451820 8:134540239-134540261 GAGGACAGACAGTAGGTGGGAGG + Intronic
1048527809 8:135219952-135219974 CAGGATACACAGAAGGATGCAGG + Intergenic
1048943093 8:139419455-139419477 GAGGATTCAAAGAAGGAGTGGGG + Intergenic
1050034441 9:1420690-1420712 GATGATTTACAGAAGAAGCGAGG - Intergenic
1050495192 9:6233436-6233458 GAGGAGATACAGAAGAGAGGGGG - Intronic
1051695895 9:19767597-19767619 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1052902088 9:33801985-33802007 GAGGGAAGAGAGAAGGAGGGTGG - Intergenic
1053306531 9:36988019-36988041 GAGAAGATGAAGAAGGAGGGAGG + Intronic
1054831286 9:69627937-69627959 AAGCATACACAGGAGGAGGGAGG - Intronic
1054857688 9:69918649-69918671 GAGGTCATACAGAAGTGGGGAGG - Intergenic
1055658142 9:78472921-78472943 GAGGATTTCCAGAAGGAAGGTGG + Intergenic
1055852028 9:80643067-80643089 TAGGATATACAGAAGTAAGGTGG + Intergenic
1056422495 9:86442952-86442974 AAGGAAAGAGAGAAGGAGGGAGG - Intergenic
1056847719 9:90055261-90055283 GATGCTTTCCAGAAGGAGGGTGG + Intergenic
1056898225 9:90571547-90571569 GAACAAATACAGAAGGAGAGAGG + Intergenic
1057395983 9:94680805-94680827 GAGGTTATACTGGAGGAGGGAGG + Intergenic
1057396939 9:94689032-94689054 CAGGAAATACACAAGGAAGGTGG - Intergenic
1060735795 9:126066034-126066056 GAGGACAGACAGAACGGGGGTGG - Intergenic
1060967645 9:127720803-127720825 GAGGGAAGAAAGAAGGAGGGAGG - Intronic
1061489861 9:130938914-130938936 GCGGAGATTGAGAAGGAGGGAGG - Intronic
1062143990 9:134978888-134978910 GAGGATAGAGGGAGGGAGGGAGG + Intergenic
1062144046 9:134979062-134979084 GAGGAAAGAGAGAAGGAGGAAGG + Intergenic
1062190716 9:135246619-135246641 GAGGATGAGCAGAAGGAAGGAGG - Intergenic
1062473021 9:136714496-136714518 GAGGACAGCCAGGAGGAGGGAGG - Intronic
1185512541 X:674206-674228 GAGGTTGTACTGGAGGAGGGTGG - Intergenic
1185661991 X:1735428-1735450 GAGCAGAAAGAGAAGGAGGGAGG - Intergenic
1185726622 X:2426863-2426885 GAAGATGGACAGAAGGAAGGAGG - Intronic
1185745945 X:2573529-2573551 GAGCATTTGCAGAGGGAGGGAGG + Intergenic
1186077575 X:5897879-5897901 GAGGAAGGAAAGAAGGAGGGAGG - Intronic
1186207698 X:7217223-7217245 GAGGTTGAACAGATGGAGGGGGG + Intergenic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1186590120 X:10921408-10921430 GAGGAGAAATAAAAGGAGGGAGG - Intergenic
1186946456 X:14573817-14573839 GAGGATATAAAGAAGGAGTGGGG + Intronic
1187030534 X:15483513-15483535 GAGTAAATACAGAAGGTGAGAGG - Intronic
1187186486 X:16991628-16991650 GAGGTTATACCGGAGTAGGGTGG + Intronic
1187561819 X:20410606-20410628 GAGGAAAGAGAGAATGAGGGAGG - Intergenic
1187665248 X:21601311-21601333 CAGGATATGCAGAAAGAGAGAGG + Exonic
1188013787 X:25085623-25085645 TAGGATATAGAGAAAGGGGGAGG - Intergenic
1188193129 X:27196830-27196852 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1188237392 X:27747247-27747269 GAAGAGATACAAGAGGAGGGAGG + Exonic
1188402540 X:29764597-29764619 GAGGACATAAAAAAGGAGGTTGG + Intronic
1188626657 X:32293414-32293436 GAAGAGAACCAGAAGGAGGGAGG + Intronic
1189055399 X:37694386-37694408 GAGGAGATTGAGAAGGAGGTGGG + Exonic
1189161425 X:38813111-38813133 GAGGATATACAGATAAAGCGAGG + Intergenic
1190618597 X:52263261-52263283 AGGGAAATAAAGAAGGAGGGAGG - Intergenic
1191135488 X:57059245-57059267 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1191809865 X:65175174-65175196 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1193013914 X:76710688-76710710 GAGGTCATACTGAAGTAGGGTGG - Intergenic
1193341384 X:80352970-80352992 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1193646659 X:84078791-84078813 GAAGATATAGGGCAGGAGGGAGG + Intronic
1194638915 X:96378514-96378536 AAGGAGAAACAAAAGGAGGGTGG + Intergenic
1196861380 X:120031644-120031666 CAAGGTTTACAGAAGGAGGGAGG + Intergenic
1197782830 X:130174007-130174029 GGGAATCTAAAGAAGGAGGGAGG + Intronic
1197923847 X:131626064-131626086 GAGAATTTAAAGAAGGAGGAGGG + Intergenic
1198383392 X:136105123-136105145 GAGGAGAGAGAGGAGGAGGGAGG + Intergenic
1200338024 X:155372697-155372719 GAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1200348445 X:155467997-155468019 GAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1200957525 Y:8967103-8967125 GAGGAAGGACAGAAGGAAGGAGG - Intergenic
1201376662 Y:13330374-13330396 GAGGGCAAACAGAAGCAGGGTGG + Intronic
1201517742 Y:14835833-14835855 GAGGAAGGAAAGAAGGAGGGAGG + Intronic
1201696190 Y:16829102-16829124 GAGGAGAGACTGAGGGAGGGAGG + Intergenic
1201741086 Y:17325402-17325424 GAGGAAAGAAAGAAGGAGAGAGG + Intergenic