ID: 1023466548

View in Genome Browser
Species Human (GRCh38)
Location 7:40462134-40462156
Sequence CCAGAAGTTAAGTGTGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023466546_1023466548 -5 Left 1023466546 7:40462116-40462138 CCAGGACAAGGAAGAATGCCAGA 0: 1
1: 0
2: 1
3: 24
4: 312
Right 1023466548 7:40462134-40462156 CCAGAAGTTAAGTGTGAAGCTGG No data
1023466543_1023466548 14 Left 1023466543 7:40462097-40462119 CCATGAAAAATAATACAGGCCAG 0: 1
1: 0
2: 2
3: 41
4: 300
Right 1023466548 7:40462134-40462156 CCAGAAGTTAAGTGTGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023466548 Original CRISPR CCAGAAGTTAAGTGTGAAGC TGG Intronic
No off target data available for this crispr