ID: 1023468235

View in Genome Browser
Species Human (GRCh38)
Location 7:40482970-40482992
Sequence GAGAGCTCATAAATGCTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023468229_1023468235 17 Left 1023468229 7:40482930-40482952 CCATCTTTTGTGTGGCCTGCAAA 0: 1
1: 0
2: 3
3: 25
4: 217
Right 1023468235 7:40482970-40482992 GAGAGCTCATAAATGCTAGGGGG 0: 1
1: 0
2: 0
3: 4
4: 86
1023468230_1023468235 2 Left 1023468230 7:40482945-40482967 CCTGCAAATTGACATGCAGACAA 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1023468235 7:40482970-40482992 GAGAGCTCATAAATGCTAGGGGG 0: 1
1: 0
2: 0
3: 4
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023468235 Original CRISPR GAGAGCTCATAAATGCTAGG GGG Intronic
903803515 1:25987935-25987957 GATAGCCCAGAAATGCTAGAAGG - Intronic
907492262 1:54815790-54815812 GAGAGCTGTTAAATGCTCTGGGG - Intronic
908087167 1:60647937-60647959 GAGAACTCATTAATGCAGGGAGG + Intergenic
917030164 1:170681701-170681723 TAGAGCTCATAAGGGCTGGGTGG - Intronic
920312841 1:205058605-205058627 GAAAGCTCATGAAGGCTGGGGGG + Exonic
1064435588 10:15308324-15308346 GAAAATTAATAAATGCTAGGGGG + Intronic
1071792538 10:88970511-88970533 GAGAGGTAGTGAATGCTAGGAGG + Intronic
1073128532 10:101169084-101169106 GAGACCTCATACATGCTGGTAGG - Intergenic
1074750789 10:116585048-116585070 GAGGGTGCATAAATGCTATGAGG + Intergenic
1084063631 11:66691179-66691201 TAGAGCTCAGAAATGCTGGGAGG - Intronic
1089073475 11:115718457-115718479 TAGAGCTAATCAATGCTAGAAGG + Intergenic
1098694238 12:73531925-73531947 GAGTGCAAATAAATGCTGGGGGG - Intergenic
1098932733 12:76439034-76439056 GAGAGCTCATAAAATACAGGGGG + Intronic
1107378950 13:39834908-39834930 GAGAGCCCAAAGATGATAGGTGG + Intergenic
1117871677 14:60207614-60207636 GAGAGGTCATTAATTCTAGCAGG - Intergenic
1121917447 14:97848705-97848727 GAGAGCTCATTAATGCTCTCTGG - Intergenic
1124380229 15:29159343-29159365 TACAGCTCATAAAGGCAAGGTGG + Intronic
1124853581 15:33364882-33364904 GAGGGCTCATTAATGGAAGGAGG + Intronic
1126273173 15:46845660-46845682 GAGAGCTCAGAAAAGACAGGAGG - Intergenic
1126966826 15:54063468-54063490 GAGAGCTGATGACTCCTAGGAGG - Intronic
1129373868 15:75115432-75115454 TACAGCTCATAAAAGCAAGGTGG + Intronic
1129542995 15:76366392-76366414 GAGAGCCCATAAATGTTCCGTGG - Intronic
1133989069 16:10690880-10690902 GAGAACTCAGAAATGGGAGGGGG + Intronic
1141027367 16:80561009-80561031 GGGAACTCACAAATGCTTGGGGG - Intergenic
1158246104 18:55433806-55433828 AAGAGCTCATAAAACCAAGGAGG - Intronic
1160043107 18:75363280-75363302 GATAACTCATAAATGCAAGCAGG - Intergenic
1160305184 18:77726950-77726972 GACAGCTCATAAATGGAAGCTGG - Intergenic
1161930462 19:7336381-7336403 GAGGGCTCAGGAATCCTAGGTGG - Intergenic
1168660023 19:58158188-58158210 TACAGCTCATAAATGCAATGCGG - Intergenic
925948726 2:8891328-8891350 GAGAGCTCAGAAATGCAAATTGG + Intronic
927918612 2:26953404-26953426 GAGAGCTTATAACTGGCAGGAGG - Intergenic
929868229 2:45736337-45736359 GAGAGCTATTACATGATAGGCGG + Intronic
929875434 2:45792770-45792792 GAGCACTGATAAATGGTAGGTGG + Intronic
935847234 2:107179204-107179226 AATAGCTCATATATGCAAGGTGG + Intergenic
936429854 2:112453116-112453138 GACAGCTCCTAAATGTCAGGAGG - Intergenic
939484497 2:142793325-142793347 GAGGGCTCCTAAATGTTAGAAGG - Intergenic
941537146 2:166738495-166738517 GTGAGCTCATAAATGTTGTGTGG + Intergenic
942069332 2:172301520-172301542 GAGAACTCATAGAAGGTAGGGGG - Intergenic
942567570 2:177281848-177281870 TACAGCTCAAAAATGCCAGGTGG - Intronic
943534033 2:189124300-189124322 GAGGCCTCAGAAAAGCTAGGGGG - Intronic
1172310568 20:33915205-33915227 ATGAGCTCATAAATACTGGGGGG - Intergenic
1172976064 20:38906920-38906942 CAGAGCTCAGAAAGCCTAGGAGG - Intronic
1175169489 20:57070164-57070186 GACAGCCCATCAATGCCAGGAGG - Intergenic
1184551461 22:45206459-45206481 AAGAGCTCATATTTGCTAAGTGG + Intronic
950699011 3:14727241-14727263 GAGAGCTCAGAAATGCAAGTGGG - Intronic
952376188 3:32769453-32769475 GAGACCTCAAACATGCTACGTGG + Intronic
953653853 3:44832374-44832396 CAGAGCTAAGAAATGCTAGTGGG + Intronic
957040248 3:75330677-75330699 CAGAGCTCAGAAATGCTAGCAGG - Intergenic
957258892 3:77874882-77874904 GAAACGTCATAAATGCAAGGAGG + Intergenic
961045042 3:123702257-123702279 CAGAGCTCAGAAATGCCAGCAGG - Intronic
965249974 3:166330204-166330226 GCAAGCTCATAAATACTAAGTGG + Intergenic
970547824 4:17147724-17147746 GAAAACTCATGAATGCCAGGAGG + Intergenic
971605581 4:28652874-28652896 GAAATCTCAGAAATTCTAGGTGG - Intergenic
972295415 4:37733192-37733214 GAGAGCTAATACATCCTAGTGGG - Intergenic
975869425 4:78762266-78762288 GAGACATAATAAATGCTAGCTGG + Intergenic
976311637 4:83619185-83619207 GAGAGGTGATAAATGTTGGGTGG + Intergenic
977925182 4:102692590-102692612 GAGATCTCAAAAAAGCTTGGAGG + Intronic
985411708 4:189692365-189692387 TAGAGCTCATAAAGGCAATGTGG - Intergenic
986635768 5:9820898-9820920 GAGAGCTCAGGAATGCTGGTGGG - Intergenic
993555451 5:89331107-89331129 GTGAGCACATAAATGCTCAGAGG - Intergenic
999301800 5:150495731-150495753 GACAGCTTATAAATGCTTGCTGG + Intronic
1001885488 5:175286658-175286680 CTGAGCTCATACATGTTAGGTGG - Intergenic
1003717882 6:8667285-8667307 GACAGCTCATAAAAGCAACGTGG - Intergenic
1004784394 6:18950449-18950471 GAGAACACATGGATGCTAGGAGG + Intergenic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1010462710 6:76131791-76131813 GAGAGATCATAAAGTCTAGAAGG + Intergenic
1010473587 6:76260409-76260431 GAGAACACACAAATACTAGGAGG - Intergenic
1013044379 6:106469931-106469953 GAGATCTCATTTATGCTATGGGG + Intergenic
1013154336 6:107478604-107478626 CAGAGCTCATAGGTCCTAGGAGG - Intergenic
1017591816 6:155986086-155986108 AAGTGCTTATAAATGCAAGGAGG - Intergenic
1020998548 7:15297317-15297339 AAGAGTACATAAATCCTAGGTGG + Intronic
1021324385 7:19247419-19247441 GAGAGATCAAAAATGCTCAGGGG + Intergenic
1023468235 7:40482970-40482992 GAGAGCTCATAAATGCTAGGGGG + Intronic
1028032551 7:85933852-85933874 GAGAGATAATAAATGCTAGCAGG - Intergenic
1028143961 7:87301081-87301103 GAGAACACACATATGCTAGGAGG + Intergenic
1030327825 7:108239893-108239915 GAGTGATGATAAATGCTGGGAGG + Intronic
1031938031 7:127756090-127756112 TAGAGCTGATAAATGCCAGTGGG + Intronic
1034230633 7:149524759-149524781 GAGAGATTATAAATGGGAGGAGG + Intergenic
1036014567 8:4768081-4768103 GAGAACACATAACTGCTGGGTGG - Intronic
1042963309 8:74325264-74325286 GAGAGCTTTCAAATGCTCGGCGG + Intronic
1043935137 8:86133790-86133812 GAGGGCTCATTACTGCTGGGAGG - Intronic
1049822492 8:144644605-144644627 CAGAGCTCAGAAATGCATGGTGG - Intergenic
1050494249 9:6223897-6223919 GAGAGATCATAGATGCTCTGAGG - Intronic
1058747371 9:108004970-108004992 AAGTGCTCCTAAATGCTATGTGG + Intergenic
1187263796 X:17712081-17712103 GAATGCTCATAAATGCTGGTGGG - Intronic
1188537894 X:31217811-31217833 GAATTCTCATTAATGCTAGGAGG - Intronic
1192564604 X:72153420-72153442 GAGAGCTCAAAACAGCTATGTGG + Intergenic
1195264213 X:103164312-103164334 GAGAGCTTATTACTGCTGGGTGG + Intergenic
1197533644 X:127662421-127662443 TACAGCTCATAAATGCTGTGTGG + Intergenic
1201782703 Y:17741017-17741039 GAGAGATCATTATTGCCAGGAGG + Intergenic
1201818850 Y:18164971-18164993 GAGAGATCATTATTGCCAGGAGG - Intergenic