ID: 1023468895

View in Genome Browser
Species Human (GRCh38)
Location 7:40491499-40491521
Sequence GGGATGCTAATGCATCTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023468894_1023468895 -4 Left 1023468894 7:40491480-40491502 CCGTGGTCATGATATCATGGGGA 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1023468895 7:40491499-40491521 GGGATGCTAATGCATCTGAATGG 0: 1
1: 0
2: 2
3: 11
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023468895 Original CRISPR GGGATGCTAATGCATCTGAA TGG Intronic
907193771 1:52669686-52669708 AGGATGCTAAGACATCTGGAAGG + Intergenic
907881666 1:58555098-58555120 GGGAGGCTAAGGCAGGTGAATGG + Intergenic
913080469 1:115380352-115380374 GGGGTGCTAATACCTATGAAAGG - Intergenic
917993942 1:180414970-180414992 GGGAGGCTGAGGCATCAGAATGG + Intronic
920874744 1:209823858-209823880 TGGATGCTAAGGAATCTGCAAGG - Intergenic
922540042 1:226411933-226411955 GAGATTCTAATGCACCCGAAAGG - Intergenic
1064795925 10:19010806-19010828 GGGATGCTAAGGCAGGAGAATGG - Intergenic
1066337018 10:34488468-34488490 GGGATGCAAATGAATCTTCATGG + Intronic
1067902403 10:50255904-50255926 ATCATGCCAATGCATCTGAAAGG - Intergenic
1070394766 10:76002513-76002535 GGGATGGTAATCAATCTGTAGGG + Intronic
1071617681 10:87091549-87091571 GGTAAGCTAAAGGATCTGAAGGG - Intronic
1072329958 10:94337860-94337882 GGGATGATAATGCCTCTGAAGGG + Exonic
1074011626 10:109487719-109487741 GTGATGCCAATGCTGCTGAATGG + Intergenic
1074741938 10:116493789-116493811 GGGAGGCTAAGGCAGCAGAATGG - Intergenic
1075182406 10:120223597-120223619 GCCAAGCTAAAGCATCTGAATGG - Intergenic
1078620469 11:12902583-12902605 GGAATGCTAATGGGTCAGAATGG + Intronic
1078758281 11:14232095-14232117 CAGATGCTGATGCATATGAAAGG - Intronic
1080004766 11:27394973-27394995 GGGATGCTATGGCATCGGAATGG - Intronic
1083247853 11:61443876-61443898 GGGATGCTGAGGCAGCAGAATGG - Intronic
1083513036 11:63229345-63229367 TGGAAGCTCATTCATCTGAATGG - Exonic
1088480549 11:110292542-110292564 TTGATGCCAATGCATCTTAAAGG + Intronic
1089484640 11:118835926-118835948 GGGAGGCTGAGGCAGCTGAATGG + Intergenic
1093267259 12:17018045-17018067 GGGAGGCTAAGGCAGGTGAATGG - Intergenic
1093532457 12:20183661-20183683 GGGAAGCAAATCCATCTTAAAGG - Intergenic
1096189874 12:49609548-49609570 AGGCTGCTAATTCATGTGAACGG - Intronic
1096888788 12:54744950-54744972 GGGTTAGCAATGCATCTGAATGG + Intergenic
1105214178 13:18274702-18274724 GGGGTGCTAATGTTTCTGGATGG - Intergenic
1106107788 13:26749311-26749333 GGGATGCTGATGGATCTCAAAGG - Intergenic
1107419839 13:40236067-40236089 GGCATGCTAATGCAGTGGAAAGG - Intergenic
1108443241 13:50477895-50477917 GGGATGTTGATGCAGATGAAGGG + Intronic
1110915615 13:81016725-81016747 GGGCTGCTAATACAGCTGAGTGG + Intergenic
1117202483 14:53406506-53406528 GGAAAGCTAATGCCACTGAATGG - Intergenic
1117583040 14:57172105-57172127 GTGATCCTATGGCATCTGAAAGG - Intergenic
1117860321 14:60084842-60084864 GGGCTGCTTTTGCTTCTGAAAGG + Intergenic
1120683367 14:87507999-87508021 GGGTTGCTAATCCATATTAAAGG - Intergenic
1121801661 14:96779244-96779266 GGGAGGCTGAGGCATGTGAATGG - Intergenic
1122926260 14:104903619-104903641 GGGATGCTATTTCAAGTGAAAGG - Intergenic
1126234995 15:46373358-46373380 GGGATTCTAGAGCATCTGGATGG + Intergenic
1127006778 15:54579652-54579674 GGGATGCTAAGGCAGAAGAATGG + Intronic
1127293241 15:57588851-57588873 GGGATGCTGTCGCAGCTGAATGG + Intergenic
1128570181 15:68728049-68728071 GGGTTGCTATGGCATCTGATTGG - Intergenic
1135078789 16:19416423-19416445 GGGATGCTAATCCATCACAAAGG - Intronic
1136225709 16:28859044-28859066 GGGAGGCTAAGGCATGAGAACGG - Intronic
1138153026 16:54676923-54676945 GGGTTGCTATTAAATCTGAAAGG + Intergenic
1141663147 16:85452572-85452594 GGGGTGCTGCTGCATCTCAAAGG + Intergenic
1141740809 16:85891568-85891590 GGGCTGCTCATGCATGTGACTGG + Intergenic
1142340550 16:89519483-89519505 GGGAAGCTAAGGCAACAGAATGG - Intronic
1148246985 17:46038882-46038904 GGGACGCTACTGCTTCTAAATGG - Intronic
1151418221 17:73980699-73980721 GGGATGCTATTGCAGCTGAGAGG - Intergenic
1152249188 17:79202806-79202828 GGCATGATAGTGCATCTGCATGG - Intronic
1156666700 18:39416961-39416983 GGGAGGCTAAGGCAGCAGAATGG + Intergenic
1158571696 18:58601972-58601994 GGGGTGCTACTGCATCTGGCGGG - Intronic
1162139725 19:8578503-8578525 GGGAAGCAGGTGCATCTGAAAGG + Intergenic
1164031215 19:21407391-21407413 GGGAGGCTAATGCAGGTGAATGG - Intronic
1166327825 19:42062095-42062117 GGGATCCTAATCCATCTGGGAGG - Intronic
1167549761 19:50152315-50152337 GGGAAGGAAATGCATCCGAAAGG - Intergenic
1168456281 19:56511284-56511306 GAGTACCTAATGCATCTGAATGG + Intronic
927139236 2:20118403-20118425 GGGATGCTCATGCCTCTGAGGGG + Intergenic
931361327 2:61580296-61580318 GTGATGGAAATACATCTGAATGG + Intergenic
931522286 2:63112035-63112057 GGGAAGCTATTGCATCTGTGGGG - Intergenic
931719002 2:65053906-65053928 GGGATGATGATGAAACTGAAAGG + Intergenic
933386030 2:81611268-81611290 GGGATGATAATGTCTATGAATGG + Intergenic
934118906 2:88821849-88821871 GGGCTGCTGATGCTTCAGAAAGG + Intergenic
934300141 2:91772048-91772070 GGGGTGCTAATGTTTCTGGATGG + Intergenic
934678960 2:96268941-96268963 GGGGTGGTAATGCATTTAAATGG + Intronic
935609404 2:105005366-105005388 GGCATGCTAATGGAGGTGAAAGG - Intergenic
936162355 2:110094199-110094221 GGGCTGCTGATGCTTCAGAAAGG + Intronic
936182305 2:110277167-110277189 GGGCTGCTGATGCTTCAGAAAGG - Intergenic
937158517 2:119738704-119738726 GGGAGGCTAAGGCAGCAGAATGG + Intergenic
942847373 2:180442850-180442872 GGGCTGCAAGTGTATCTGAAAGG - Intergenic
943451338 2:188045618-188045640 GGGAGGCTAAGGCAGGTGAATGG + Intergenic
943540651 2:189209667-189209689 TGGATGCTAATTCAACAGAAAGG + Intergenic
946106228 2:217372349-217372371 GACATGCAAATGCATTTGAATGG + Intronic
947369661 2:229431845-229431867 GGGATGCAAATGAATCTGCCAGG + Intronic
947838559 2:233192165-233192187 CGGATGCAAGAGCATCTGAATGG + Intronic
948688932 2:239690056-239690078 GGGCTGCTTCTGCCTCTGAAAGG + Intergenic
1169215897 20:3794777-3794799 GGTGGGCCAATGCATCTGAAGGG - Intronic
1170321052 20:15098452-15098474 GGGATGCTAAGTTCTCTGAAAGG + Intronic
1173276351 20:41587444-41587466 GGAAAGCTGATTCATCTGAAAGG - Intronic
1174807601 20:53617935-53617957 GAGATGCTATTGCATGTGCAAGG + Intergenic
1181555881 22:23671475-23671497 GGGGTGCTAATGTTTCTGGATGG - Intergenic
1181698496 22:24607178-24607200 GGGGTGCTAATGTTTCTGGATGG + Intronic
1182039336 22:27224333-27224355 GGGGTGAAAATGCTTCTGAAGGG + Intergenic
1183618089 22:38957007-38957029 GAGATGCTAAAGGCTCTGAAAGG - Intronic
949944060 3:9176311-9176333 GGCATGAAAATGCATATGAAGGG + Intronic
950420715 3:12897516-12897538 GCGATGCAGATGCATCTGAATGG + Exonic
950447806 3:13048218-13048240 GGGCAACGAATGCATCTGAAAGG + Intronic
951045032 3:18028487-18028509 CAGATGCTAATAAATCTGAAGGG - Intronic
951325438 3:21297035-21297057 GGGTTGCTAATGCATGTGAATGG - Intergenic
955144101 3:56299230-56299252 GGGATGCTGAGGCAGCAGAAAGG - Intronic
955708301 3:61751886-61751908 GGGAGGCTAAGGCAGCAGAATGG + Intronic
956470134 3:69557786-69557808 GGGAAGGTAATGAATCTTAAAGG + Intergenic
958609251 3:96403098-96403120 GGGAAGCGAATGAATCTCAAAGG - Intergenic
959392153 3:105788999-105789021 GGGATGCTAGTTCAGCTGGAAGG - Intronic
970340627 4:15103178-15103200 GAGATGCTAATGCATGTGGTTGG - Intergenic
970372073 4:15418193-15418215 GGGAGGCTGATGCAGCTGAGTGG - Intronic
971922262 4:32956629-32956651 GGGATGCTAAGGCAGGAGAATGG + Intergenic
975257190 4:72251734-72251756 GGGATCATAATGCAACAGAAAGG + Intergenic
976873032 4:89819561-89819583 GGGATGCTAAAAAATCTGGATGG - Intronic
980658179 4:135817060-135817082 AGGATACTAAGACATCTGAAAGG + Intergenic
982021419 4:151208780-151208802 GGGAGGCTAAGGCAGGTGAATGG - Intronic
983778956 4:171644106-171644128 GGGATGCTGAGGCAGCAGAATGG + Intergenic
986759861 5:10870094-10870116 GGAATTCTCATGTATCTGAAGGG - Intergenic
986818336 5:11437405-11437427 TGGATTCTCATGCATCTGGAAGG - Intronic
986893861 5:12341647-12341669 AGGATGCTAATACATGTGATGGG - Intergenic
989377879 5:40784255-40784277 GGAATGCTATTGCATCTACATGG - Intronic
991017932 5:61951122-61951144 GGGAGGCTAAGGCATGAGAATGG - Intergenic
992711257 5:79459594-79459616 AGGATGTTACTGCATCTGACAGG + Intronic
995640109 5:114246285-114246307 GGGATGATTATGCATCTTATTGG + Intergenic
997218126 5:132131715-132131737 GGGATGTTTATGCATGTGTAGGG - Intergenic
998077791 5:139250461-139250483 GGGAGGCTAAGGCATGAGAATGG + Intronic
998831759 5:146167506-146167528 GGGAGGCTGAGGCATCAGAATGG - Intronic
999951157 5:156652382-156652404 GGGATGCTAAGGCATGAGGATGG + Intronic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1000420237 5:161030387-161030409 GGGGAGCTGATGCATCTAAAGGG + Intergenic
1002163429 5:177330910-177330932 GAGATTCAAATGCAACTGAACGG + Intergenic
1005452110 6:25983494-25983516 GGGCTGCTCATGCAGATGAAGGG - Exonic
1006868142 6:37225805-37225827 GGGATGCAAATGCAAGTGATGGG + Intronic
1008314520 6:50023516-50023538 TGAATGCTAATGCTGCTGAAAGG + Intergenic
1009330180 6:62409428-62409450 GGGAGGCTGAGGCATATGAATGG + Intergenic
1019729802 7:2623590-2623612 AGGATGGTGATGCCTCTGAAGGG + Intergenic
1019980865 7:4621002-4621024 GGGAGGCTAAGGCATGAGAATGG - Intergenic
1022953930 7:35364216-35364238 GGGATGCTGATGCTTCTGGTTGG + Intergenic
1023468895 7:40491499-40491521 GGGATGCTAATGCATCTGAATGG + Intronic
1025248226 7:57334039-57334061 GGCATGCTACTGCATCTAGATGG + Intergenic
1028134700 7:87213179-87213201 GGGATGCTGGTGCATAGGAAGGG - Intronic
1032527627 7:132591741-132591763 GCAACACTAATGCATCTGAAAGG - Intronic
1041733451 8:61085929-61085951 GGGAGGCTGATGCAGCAGAATGG + Intronic
1042409248 8:68443296-68443318 TGGATACTAATGAAACTGAAGGG + Intronic
1047537584 8:125733774-125733796 GGGATGCTAATGCCTCTTTAGGG + Intergenic
1049193705 8:141303928-141303950 GGGATCCTGAGGCAGCTGAAGGG - Intronic
1051261253 9:15266972-15266994 GGGAGGCTAAGGCAGCAGAATGG + Intronic
1052018257 9:23495274-23495296 GGGATGCACCTGCATCTGAAAGG + Intergenic
1053237646 9:36470093-36470115 GTGATGCTAATGCACATGAAGGG - Intronic
1057929558 9:99181782-99181804 GAGATGCTGACGCATTTGAAAGG - Intergenic
1058624037 9:106915597-106915619 GGGAAACTAATGTATCTGAATGG + Intronic
1061649488 9:132035586-132035608 AGGATGCAAATGCATCTTAGAGG + Intronic
1187828509 X:23356989-23357011 GGGAAGCTAATGCTCCAGAAGGG + Intronic
1188286262 X:28328640-28328662 TGGATGATTATGCATTTGAATGG + Intergenic
1192901278 X:75500082-75500104 AGGATGCAAATGCATAAGAATGG + Intronic
1199829486 X:151535300-151535322 GTGATGCTAAGGCAGCTCAAAGG + Intergenic
1199967605 X:152832805-152832827 GGGATACTTTTGCATCTCAATGG + Intronic