ID: 1023470701

View in Genome Browser
Species Human (GRCh38)
Location 7:40515118-40515140
Sequence CCATGACCACAATCAAAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023470701 Original CRISPR CCATGACCACAATCAAAACA CGG Intronic
901535892 1:9882904-9882926 CCAGGGCCAGAATCGAAACACGG + Intronic
902748466 1:18489590-18489612 ACATGACCAGATTCAAGACATGG - Intergenic
903710883 1:25323317-25323339 CCATCACCACCATCAAGACAAGG + Intronic
903716063 1:25368112-25368134 CCATCACCACCATCAAGACAAGG - Intronic
904080343 1:27868698-27868720 CAATGACCACAATACAAAGACGG - Intergenic
904450961 1:30611221-30611243 CTATGAACACAATGAAAACAGGG - Intergenic
904632789 1:31855339-31855361 CCATGACCTCAAGTCAAACAAGG + Intergenic
905475866 1:38227576-38227598 ACACCACCACAATCAAGACAGGG + Intergenic
905476763 1:38234278-38234300 CCATCAGCAGGATCAAAACAGGG - Intergenic
905595544 1:39203544-39203566 CCACCACCACAATCAACAAAAGG + Intronic
907660029 1:56383455-56383477 CCATGAGAAAAATCAAAGCAAGG - Intergenic
908490668 1:64640824-64640846 AAATGACCACAATAAAAAGAGGG - Intronic
910551643 1:88482059-88482081 CAATGATTTCAATCAAAACAAGG - Intergenic
916119364 1:161513793-161513815 CCATAACCAGACTCAAAGCAAGG - Intronic
916129126 1:161595451-161595473 CCATAACCAGACTCAAAGCAAGG - Intronic
917034313 1:170730192-170730214 CCATGACCACGATCAAATGAGGG - Intronic
917127907 1:171707363-171707385 ACATGACCACAATCAAATATAGG + Intronic
917139780 1:171824345-171824367 CCATGAAGACAAGCAAAACAGGG + Intergenic
917903055 1:179562661-179562683 TCATGAAGACAAACAAAACATGG - Intronic
919607348 1:199701081-199701103 GCATAACCTCAATCAAATCATGG + Intergenic
920812060 1:209295575-209295597 CCACCACTACAATCAAGACAAGG - Intergenic
922967861 1:229706963-229706985 CCATTAACACAATCATCACAGGG - Intergenic
924088572 1:240479389-240479411 CCTTGTCCAAAAACAAAACAGGG + Intergenic
1063041470 10:2342728-2342750 ACATGACCAGAAGCCAAACAAGG + Intergenic
1063156716 10:3386236-3386258 CTATCACCACAATCAAGATAGGG - Intergenic
1064479767 10:15727595-15727617 ACATTAACACAATAAAAACAAGG - Intergenic
1064880316 10:20044706-20044728 ACATCTCCACAATCAGAACAAGG + Intronic
1065160750 10:22918843-22918865 CCATGACCCCAGTCTAACCATGG - Intergenic
1066200351 10:33138041-33138063 CCATCACCTCCATCATAACAGGG - Intergenic
1071488732 10:86121650-86121672 CCATGACCACAATAATACCAGGG + Intronic
1072409762 10:95190489-95190511 CCATCACCATAATCAAGATATGG + Intergenic
1072658866 10:97349871-97349893 CCATAATCACAATGCAAACAGGG + Intergenic
1074004119 10:109402325-109402347 CCATTACCACAATCAAAGTAAGG - Intergenic
1074159555 10:110826330-110826352 CCATCACCACAATCAAGACTGGG + Intronic
1074277494 10:112018048-112018070 CAATGCCCACAATCAAGAGAGGG + Intergenic
1076370461 10:129949608-129949630 CCATGCCCATAATCAAATCCCGG + Intronic
1078051974 11:7973613-7973635 CCACCACCACAGTCAAGACATGG - Intronic
1080357572 11:31468979-31469001 GGATGGCTACAATCAAAACATGG - Intronic
1080404181 11:31964327-31964349 CCAGGCCCACAATCACAACAGGG - Intronic
1080406279 11:31982344-31982366 CCATCACCACAAAAAGAACATGG - Intronic
1081901108 11:46628839-46628861 TCACCACCACAATCAAAACATGG + Intronic
1083520624 11:63308854-63308876 TCATGACAAAAATCAAAACGTGG - Intronic
1084064752 11:66697399-66697421 CCCTGAGCACAATCAACACTTGG + Intronic
1086319753 11:85632730-85632752 CCATCACCACAATTAAAATTTGG + Intronic
1087394114 11:97574484-97574506 ACATGAGCACAAGTAAAACAGGG + Intergenic
1088532187 11:110822348-110822370 CCAAGACCACACTGTAAACAGGG - Intergenic
1089725678 11:120477280-120477302 CCATTACCACAGTCAACACCTGG + Exonic
1089740665 11:120579833-120579855 CCACCACCACAATCAAGATATGG + Intronic
1095940249 12:47722121-47722143 CCAAGCCCCCAAACAAAACAGGG - Intronic
1096291213 12:50344949-50344971 CCATGTCAAAAAACAAAACAAGG + Intronic
1098037009 12:66314020-66314042 TGATGACCACAAACAAACCATGG + Exonic
1098360586 12:69650728-69650750 CCATCCCCTCAATCAAAACATGG - Intronic
1099451953 12:82818591-82818613 TCATGTCCACAATCAAACAAGGG - Intronic
1100894677 12:99168105-99168127 CCATCACCACAATCAAGAAAAGG - Intronic
1102209353 12:111113353-111113375 CTTTGACCACAATCAGAATATGG + Intronic
1102370010 12:112374996-112375018 CCATCACCACAATCAAAATAGGG + Intronic
1102592497 12:113967359-113967381 CCATCACCACAATCAATGCTAGG + Intergenic
1104117481 12:125763741-125763763 ACATGACTACAAACAAAACTGGG - Intergenic
1106842398 13:33698193-33698215 CCATCACCACAATCAAGATGTGG + Intergenic
1107172606 13:37360542-37360564 CAATGAACAAAATGAAAACAAGG - Intergenic
1107349772 13:39501734-39501756 CCATGACCACACTAAGAGCAGGG - Intronic
1109408340 13:61931226-61931248 ACAGGACAACAATCAGAACATGG - Intergenic
1112189768 13:97164778-97164800 CCAGGAGCAAAATCAGAACAGGG - Intergenic
1112204589 13:97311714-97311736 CCATGACCTCAAAGCAAACAAGG - Intronic
1112418834 13:99228796-99228818 TCATGACCAAAATGCAAACAAGG - Intronic
1115082511 14:29473938-29473960 CCACAATCACAATGAAAACAAGG - Intergenic
1116067245 14:40000322-40000344 CCATCAGCACAGTTAAAACAAGG - Intergenic
1116185439 14:41594971-41594993 CCACTACCAGAATCAGAACAGGG + Intergenic
1117099076 14:52327103-52327125 CCACTACCACAGACAAAACATGG + Intronic
1119556196 14:75554872-75554894 TTATGACCACAATCAGAAAAGGG + Intergenic
1120016311 14:79477908-79477930 TCATTACCAAAAACAAAACAGGG + Intronic
1120183548 14:81369236-81369258 CCAGGACCCCAACCAAAACAGGG + Intronic
1120345516 14:83284945-83284967 TCCTGAGCACAATCAAAGCAAGG + Intergenic
1120524700 14:85564108-85564130 CCATGTCAACATTCAAAACAGGG - Intronic
1121883923 14:97525292-97525314 CCATGACCACAGGCAATGCAGGG + Intergenic
1125712768 15:41800307-41800329 CCATCACCACAATCAAATTTAGG + Intronic
1129121585 15:73400464-73400486 CCATCACCACAATCTAATCCTGG + Intergenic
1131426684 15:92351152-92351174 CCATGACCACAATGGAAACGTGG - Intergenic
1131699154 15:94915137-94915159 CCATGACCACAATAGAAATTGGG - Intergenic
1131928083 15:97408162-97408184 CCATCACCACAATCAAATCATGG - Intergenic
1133101164 16:3480977-3480999 GTATGACCACAGGCAAAACAGGG - Intronic
1133148086 16:3805613-3805635 CAATGATCACAATCTAGACAGGG + Intronic
1133834807 16:9358464-9358486 CCATAACCACAAAGAAATCATGG - Intergenic
1135033825 16:19060114-19060136 CTATGAAGACAATAAAAACAAGG + Intronic
1138721222 16:59082684-59082706 TCATGACCACAGTCAAGATAGGG + Intergenic
1139025553 16:62813337-62813359 CCATCACCACAATCAAGATTTGG - Intergenic
1141131009 16:81436837-81436859 CCATCACCTCAATCAAGACATGG - Intergenic
1141289956 16:82708684-82708706 CCATGACCACTCTAAAAAGAGGG + Intronic
1143889409 17:10091095-10091117 ACATGGCCACAATAAAAGCAGGG - Intronic
1143910017 17:10240469-10240491 CCATCACCACAATCTAAATTTGG + Intergenic
1144474312 17:15572049-15572071 CCACCACCACAATCAAGATATGG - Exonic
1145915814 17:28573462-28573484 CCATGACTACAAGCAAAAGTGGG + Exonic
1145952324 17:28828822-28828844 CCACAACTACAATCAAAATACGG + Intronic
1147489889 17:40856221-40856243 CCATCACCACAGTCAAGATACGG + Intergenic
1149348447 17:55762754-55762776 TCATGTCCACATTTAAAACAGGG + Intronic
1155121802 18:22828490-22828512 CCATGAAGAAAAACAAAACAGGG - Intronic
1155391227 18:25339050-25339072 CCAGGCCCACAATTAAAATATGG + Intronic
1157742155 18:50103070-50103092 CCATGAGCACAGTCAGAACAAGG - Intronic
1159355251 18:67331572-67331594 CAATGACCTAAATGAAAACAGGG + Intergenic
1161807537 19:6453748-6453770 CTATGACTACCATCCAAACAAGG + Intronic
1163309840 19:16507356-16507378 CCAGGACAAAAATCACAACAGGG - Intronic
1164944393 19:32281097-32281119 CCAAGGCCACAATCAAGATATGG - Intergenic
1167173235 19:47847814-47847836 CCATCACCATAATCAAGATAGGG - Intergenic
1167720280 19:51174967-51174989 CCATGACCTCAATAATATCATGG + Intergenic
926623048 2:15065327-15065349 CTAAGACCAGAAACAAAACAAGG + Intergenic
926691625 2:15738650-15738672 CCATGACCACAGTCAGAAAACGG + Intronic
926920902 2:17938912-17938934 CCATGATCACAGACAAAACTAGG - Intronic
928817058 2:35310000-35310022 ACATGACCACAATCTTAGCATGG - Intergenic
929995683 2:46825052-46825074 CCATGATGACAATCAAATCAGGG - Intronic
931190463 2:59995367-59995389 GCATGACCACTACCAAAGCAGGG - Intergenic
933704277 2:85278095-85278117 CCATGGCTCCAATCAAAGCAAGG + Intronic
933752841 2:85614075-85614097 CCATCACCACAATCAAGAGACGG - Intronic
934570214 2:95365925-95365947 CCATTACCACAATCAAGATGTGG + Intronic
936450522 2:112630564-112630586 ACATGAACAAAATGAAAACATGG + Intergenic
936614235 2:114032600-114032622 CCAACACCAGAATCAGAACATGG - Intergenic
942047751 2:172109669-172109691 CCATCACCACAACCAACAAACGG + Intergenic
943333311 2:186586221-186586243 CAATAACCATAATCAAACCAGGG - Intergenic
944391103 2:199220533-199220555 CCATCACCACCACCAAAAAAAGG - Intergenic
945298705 2:208195938-208195960 CCAGGACCACCATCAGGACATGG + Intergenic
945323715 2:208457979-208458001 CCATTGCCACAATCAATACTGGG + Intronic
945686412 2:212975893-212975915 CCATGACTACAGTCAAGATAGGG + Intergenic
945835252 2:214832105-214832127 GCATGAGCACAATCAGAAGAGGG + Intergenic
947119655 2:226800796-226800818 CCTTGACCACAAGGATAACAGGG + Intergenic
947899565 2:233709835-233709857 CCATCACCACATTCAAGACACGG + Intronic
948441965 2:237998052-237998074 CCATCACCACCATCACAGCAGGG - Intronic
948649235 2:239429700-239429722 ACATGACCAAAATAAACACACGG - Intergenic
1168767620 20:392439-392461 CCAAGACCACAGCCAAAATAGGG + Intronic
1169758249 20:9066177-9066199 CCATGCCCAGATTCAAAACATGG - Intergenic
1170858870 20:20084100-20084122 CCATGAACACCATCTCAACATGG - Intronic
1171319535 20:24229043-24229065 GAATGACCAAAATCTAAACATGG + Intergenic
1172566125 20:35932001-35932023 CCACCACCAGAATCAATACATGG + Intronic
1184120700 22:42448079-42448101 CCATGACCGCAGTCAAGATAGGG + Intergenic
1184132465 22:42525267-42525289 CCATGACCACAGTCAAGATAGGG + Intergenic
1184802144 22:46767913-46767935 TCATGACCACAGTGAAGACATGG + Intronic
949363380 3:3255072-3255094 CCACCACCACAATCAAGATATGG + Intergenic
949408948 3:3743089-3743111 CCAAGCCCAGAATCACAACAGGG - Intronic
950082023 3:10229450-10229472 CCACCACCACAATCAAGATACGG + Intronic
951295818 3:20933525-20933547 CAATGACCAGAATGAAAAAAAGG - Intergenic
952118214 3:30209798-30209820 CCATCAACAAAATCAAGACAAGG - Intergenic
953287677 3:41628477-41628499 GCATGACCTCAATCTAATCACGG + Intronic
953409443 3:42681894-42681916 CCACCACCACAATCAAGACAGGG - Intergenic
955539572 3:59960168-59960190 CAGTGACCACAAACAATACAGGG + Intronic
955694591 3:61623258-61623280 CCATGTCTAAAAACAAAACATGG - Intronic
956458488 3:69447522-69447544 CCACCACCACAATCAAGATATGG + Intronic
956560834 3:70572393-70572415 CCATGACCCCAGTCAAACCTGGG + Intergenic
956664704 3:71631449-71631471 CCATGTCCATAACCAAAGCAAGG - Intergenic
956731705 3:72202460-72202482 CCATGACCACAATTAAGACATGG + Intergenic
957654141 3:83050047-83050069 CAATCACCACATTTAAAACATGG - Intergenic
959571757 3:107892328-107892350 GTATGTCCACAACCAAAACACGG + Intergenic
960955812 3:123029775-123029797 GAATGAACACAATCAAAACATGG - Intergenic
961526721 3:127506528-127506550 CTAAGACCAGAAACAAAACAAGG + Intergenic
963314025 3:143739587-143739609 CAATAACCACAATAAAAATAAGG + Intronic
964357156 3:155861364-155861386 CCACCACCACAATCAAGATATGG + Intergenic
964811385 3:160668353-160668375 CCATGAATCCAATCACAACATGG - Intergenic
965705700 3:171505571-171505593 CCATCACCACAATTAAAATTTGG + Intergenic
968468761 4:766934-766956 CCTTCAGCAAAATCAAAACAGGG - Exonic
969544335 4:7814808-7814830 CCATCACCACAATCAAGACACGG - Intronic
970560191 4:17274889-17274911 CCATGGCCAGATTCAAAGCATGG + Intergenic
972015713 4:34242303-34242325 CAATGACCAGAAAGAAAACAGGG + Intergenic
974129881 4:57741297-57741319 CCACTACCACAATCAAGATATGG + Intergenic
975959423 4:79883606-79883628 CAATGATCAAAATGAAAACATGG + Intergenic
976976492 4:91171135-91171157 ACATTATCACATTCAAAACAGGG + Intronic
978836466 4:113156072-113156094 CAATGGACACAATCAAGACAGGG + Intronic
978985361 4:115005562-115005584 CTATGAGCTCAATAAAAACAAGG - Intronic
981389280 4:144169752-144169774 CCAAGACTGCAGTCAAAACAGGG - Intergenic
981742069 4:148013158-148013180 CATTGACCACTTTCAAAACATGG + Intronic
982064612 4:151642668-151642690 CCATAAACACAAGCAAAACAAGG - Intronic
982209998 4:153026756-153026778 CCATGACCACACCCAAACCCAGG + Intergenic
983432274 4:167665922-167665944 CTATGACCACTAGTAAAACAGGG - Intergenic
985983643 5:3492620-3492642 GCATCACCACAACCACAACACGG + Intergenic
988151823 5:27392931-27392953 CCAGAACCACAATAAAAACAAGG + Intergenic
988339187 5:29947344-29947366 ACACCACCACAATCAAAACATGG + Intergenic
989165312 5:38428007-38428029 CCATCAACACAATAAAAAGATGG - Intronic
989954876 5:50346650-50346672 CCACCACCACAATCATCACAAGG - Intergenic
992527347 5:77625249-77625271 CCATCATCAAAATCAAAAGATGG + Intergenic
995034271 5:107515325-107515347 CCATGCCCAGCATCAAGACATGG + Intronic
995898621 5:117044114-117044136 CCATGAGCTCAATCAGAATAGGG + Intergenic
996454320 5:123662541-123662563 CAATGATCACAATGAAAACTTGG - Intergenic
997695928 5:135860710-135860732 ACATGAGCACAGTCAACACATGG - Intronic
998635570 5:143951216-143951238 CCATAACTACACTCGAAACAGGG - Intergenic
1002413953 5:179108314-179108336 CCATCATCACAATCAAGACAGGG - Intergenic
1002932415 6:1643712-1643734 CCATCACCACAATCAACTCTAGG - Intronic
1003036348 6:2643690-2643712 CCATCACCACAATCAAGATCTGG - Intergenic
1003042727 6:2702943-2702965 CCACGTCCACAATCAAACAAAGG - Intronic
1003360975 6:5424926-5424948 CGATAACCACAATCTAACCACGG - Intronic
1008691900 6:53988413-53988435 CCTTGACCACACCCACAACAAGG - Intronic
1011436796 6:87347049-87347071 CCATCACCACAATCACAACATGG + Intronic
1012290978 6:97455066-97455088 CCATAACCTCAATCTAACCATGG + Intergenic
1015908277 6:138140342-138140364 TCATGACCACGATCAAAATATGG - Intergenic
1016393113 6:143594653-143594675 CCTGGACCATAATCAAATCAGGG - Intronic
1017275549 6:152563506-152563528 CAATTACCACAATCAACACTAGG - Intronic
1017569518 6:155729535-155729557 CAATCACCACAATCAAGATAAGG - Intergenic
1018279409 6:162169172-162169194 CCAAAACCAAAATCCAAACAAGG - Intronic
1020719134 7:11719550-11719572 CCATGTCCACATGCAACACATGG + Intronic
1020834472 7:13131868-13131890 CCATCACCACAGTCAAAATTTGG - Intergenic
1021337389 7:19420518-19420540 CAATGACCTCAAGCAAAAGAAGG - Intergenic
1021554521 7:21905637-21905659 CAATGAACACAAGCAGAACATGG + Intronic
1021591702 7:22270545-22270567 CCATGGCCAGTATCAGAACATGG - Intronic
1022259369 7:28689555-28689577 ACATTACTACAATCAAAATATGG + Intronic
1022361569 7:29664471-29664493 CCAAAACCAAATTCAAAACAGGG + Intergenic
1023470701 7:40515118-40515140 CCATGACCACAATCAAAACACGG + Intronic
1023805593 7:43870568-43870590 CCATGACCACACTGAGAAGAGGG + Intronic
1024321285 7:48073538-48073560 CAATGACCAGAAACAAAGCAAGG + Intergenic
1031443313 7:121820656-121820678 ACATCACCACAATCAATAGAAGG - Intergenic
1031459515 7:122029163-122029185 CCATGAACACAAACAATATATGG + Intronic
1032337211 7:131036566-131036588 GCATGACCTCAATCAAAGGAGGG + Intergenic
1035408405 7:158617287-158617309 CCATGTGCACCACCAAAACAAGG + Intergenic
1035629230 8:1095525-1095547 CCATTACTAAAATCAAAGCAAGG - Intergenic
1037028995 8:14078628-14078650 CCATGAACACAATCACAAGTTGG + Intergenic
1037148697 8:15608211-15608233 CCAAGAACTCAATCAAAATAAGG - Intronic
1037637208 8:20710815-20710837 GCATAACCACAAAAAAAACAGGG - Intergenic
1038571343 8:28665460-28665482 CCATGACCACACTCCAGCCAGGG - Intronic
1040860319 8:51992167-51992189 CCATGACCACAATTAAGATATGG + Intergenic
1041397930 8:57410853-57410875 CCATGAGCACAATCTAGTCATGG + Intergenic
1041850453 8:62385614-62385636 GCATGACCACAATCAATATACGG + Intronic
1042832025 8:73041084-73041106 CCAGGACCACACTCAAGATATGG - Intronic
1045913624 8:107440049-107440071 CCATCACCTAAATCTAAACATGG - Intronic
1046252099 8:111645242-111645264 ACATCACCACAATCAAAATAAGG + Intergenic
1048490649 8:134889865-134889887 CCAGGACCACTATCAAGAAAAGG - Intergenic
1051912233 9:22166719-22166741 CCAAGACTACAATTAAAACATGG + Intergenic
1052568967 9:30196936-30196958 CCATAACTACAAACAAAGCAAGG - Intergenic
1055311571 9:74987680-74987702 CCATGGCCACTATCAAGACAGGG - Intronic
1055461193 9:76521980-76522002 CCATCACCACCAGCCAAACAAGG - Intergenic
1055534278 9:77221229-77221251 CCATGACCACATCCATAACCTGG - Exonic
1185526770 X:786404-786426 CCATTTCCACAGTGAAAACAGGG + Intergenic
1187138386 X:16570306-16570328 CAATGACAACAACAAAAACAAGG - Intergenic
1189176760 X:38965307-38965329 ACACCACCACAATCAAAACAAGG - Intergenic
1189369827 X:40418875-40418897 ACATGACCCCAAGCAATACATGG + Intergenic
1190813242 X:53905483-53905505 CAAACAACACAATCAAAACATGG - Intergenic
1194682767 X:96873575-96873597 CCAACACCACAATCAAGATATGG - Intronic
1197948307 X:131864549-131864571 CCATGACCACTATCATCATATGG - Intergenic