ID: 1023474926

View in Genome Browser
Species Human (GRCh38)
Location 7:40566713-40566735
Sequence AAGCATCCACAACCTGCTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023474926 Original CRISPR AAGCATCCACAACCTGCTCA CGG (reversed) Intronic
912464910 1:109865499-109865521 ATGCTTCCACCACCTCCTCATGG + Intergenic
914994075 1:152525286-152525308 GAGAATCAACAACCTGCTCCTGG - Intronic
915294566 1:154910973-154910995 AAGCTTCCCCCACCTGCTCTGGG - Intergenic
915568812 1:156732699-156732721 AAATCTCCACAATCTGCTCATGG + Intronic
915826034 1:159077979-159078001 AAGCATGCTCAAGATGCTCAAGG + Intronic
915918851 1:159959300-159959322 ATGCATCCACCTCCTGGTCAGGG - Intergenic
917675163 1:177311860-177311882 GAGCATCCACAAACTGCTGAAGG - Intergenic
924170240 1:241331884-241331906 AAGCATCAATAACATGCTGAGGG + Intronic
1066040056 10:31540006-31540028 AAGCCTGCACATCCTGCACATGG - Intergenic
1067154321 10:43763662-43763684 GAACTTCCACAACCTGATCAAGG - Intergenic
1067509063 10:46880073-46880095 AGGCATACACAACATGCTCTTGG - Intergenic
1067653188 10:48171777-48171799 AGGCATACACAACATGCTCTTGG + Intronic
1071112450 10:82175580-82175602 AGGCATCCACAATTTGCTCTGGG + Intronic
1071940705 10:90588404-90588426 AAACATACAAAACGTGCTCAAGG - Intergenic
1073811442 10:107156327-107156349 AAGCTTAAACAACTTGCTCAAGG - Intronic
1075223820 10:120607355-120607377 TAACTTCCACACCCTGCTCATGG - Intergenic
1080487318 11:32723010-32723032 CAGCATCCACAATCTCTTCAAGG - Intronic
1081538789 11:44015049-44015071 AGGCATGCACAAACTGCTCTGGG + Intergenic
1083492227 11:63021481-63021503 AAACATCCAGCACCTGCTCTGGG + Intergenic
1084137302 11:67194729-67194751 ATAGATCCACAACCTGCTCTTGG + Intronic
1084269702 11:68022383-68022405 GAGCTTCCCCAGCCTGCTCAGGG - Intronic
1088506134 11:110529338-110529360 AAGGTTAAACAACCTGCTCAAGG - Intergenic
1088716248 11:112552440-112552462 AAGCATCAACTACTTGCTCTGGG - Intergenic
1090637026 11:128695464-128695486 AAGAATCGACTCCCTGCTCAGGG + Intronic
1090981977 11:131730831-131730853 TAGAATCAACAACCTGCCCAGGG + Intronic
1091621653 12:2093621-2093643 GAGCAGCCACCACCTGCCCAGGG - Intronic
1095426028 12:42075487-42075509 AACCATCCAGAACCAGCCCATGG - Intergenic
1101091270 12:101288379-101288401 AAGCATAAGCAACTTGCTCAAGG - Intronic
1105974069 13:25457684-25457706 AGGCCTCCACAACCGACTCAGGG - Intronic
1113398692 13:109972284-109972306 AACCTTCCACCACCTGCTCTTGG + Intergenic
1119561698 14:75595400-75595422 CAGCAAACACAACCTCCTCAAGG - Intronic
1121230364 14:92353123-92353145 ATGCATGCACAAACTGCTAAAGG - Intronic
1121687983 14:95853663-95853685 AAGGATCCACAAGATGCCCATGG - Intergenic
1123578417 15:21695304-21695326 AAGCATCCACTGACTGCCCAAGG + Intergenic
1123615042 15:22137786-22137808 AAGCATCCACTGACTGCCCAAGG + Intergenic
1123755627 15:23395613-23395635 AAGCACCCACAGCCTCCTCCTGG + Intergenic
1124025853 15:25964846-25964868 AAGCATCTCCAACCCCCTCAAGG + Intergenic
1124354830 15:28987188-28987210 AGGTATCCACAAGCTGCTAAAGG + Intronic
1128983086 15:72200425-72200447 AAGCATCCCCAAGCTCCTCTAGG + Intronic
1130902206 15:88215529-88215551 AAGCATCAACAGGCAGCTCAGGG + Intronic
1202987287 15_KI270727v1_random:429549-429571 AAGCATCCACTGACTGCCCAAGG + Intergenic
1134188395 16:12101802-12101824 AAGCATGCACATTCTGCACATGG - Intronic
1134460749 16:14427412-14427434 AAGCACCCACAGCCTCCTCCTGG - Intergenic
1134629281 16:15745308-15745330 CAGCATCCTGAACCTGCACAGGG + Intronic
1137329588 16:47479013-47479035 AGGAATTCACAACTTGCTCAAGG - Intronic
1137533799 16:49301814-49301836 AAGCATACACATTCTGCTCCTGG - Intergenic
1146184820 17:30717892-30717914 AAGCATCCACTCCTTGCCCAGGG + Intergenic
1150271011 17:63865121-63865143 TAGCATAAACAACCAGCTCAGGG + Intergenic
1151892576 17:76959283-76959305 AAGCATCCACATCCAGCTTAAGG - Intergenic
1152611467 17:81316811-81316833 AAGCAGCCAGGAGCTGCTCATGG + Intronic
1153621806 18:6986163-6986185 AAGCAACCACCTGCTGCTCATGG - Exonic
1159173734 18:64807395-64807417 AAGCATCCATCTCTTGCTCAAGG + Intergenic
1160335149 18:78031849-78031871 CAGCATCCACAGTCTGCCCAGGG - Intergenic
1162099016 19:8328550-8328572 AAGAATCCACAACAGGCTGAAGG + Intronic
1162973962 19:14197803-14197825 AAGCATCCACTCCTTGCCCAGGG - Intronic
1163811915 19:19438434-19438456 AAGCACCCACAGCCAGCCCAGGG + Intronic
925738883 2:6987656-6987678 AAGCACCCACAACCTCCACTTGG + Intronic
925860424 2:8170186-8170208 AGGTATCAACAACCTGCTGAAGG - Intergenic
926396860 2:12452381-12452403 AAGCATTTTCATCCTGCTCATGG - Intergenic
929979202 2:46663182-46663204 ATGCAGCCAAGACCTGCTCATGG + Intergenic
930013830 2:46957438-46957460 CAGCATCCAGCACCTGCTCTGGG - Intronic
938089396 2:128421457-128421479 AGGCATCCACAAACACCTCATGG - Intergenic
938694151 2:133819985-133820007 AAGCATCCATTCCCTGCCCAAGG - Intergenic
939214135 2:139214166-139214188 AAAAAACCACAACCTGCTGAGGG + Intergenic
943480594 2:188412163-188412185 AAGCAAACACATCCTTCTCATGG + Intronic
947859640 2:233349354-233349376 AAGCTTCCACTTTCTGCTCAGGG - Intergenic
948031445 2:234820996-234821018 GAGCATCAACAACCTTCCCAGGG - Intergenic
948450129 2:238064201-238064223 AGGCATCCACAAGCTGCACTTGG - Intronic
1169875456 20:10292450-10292472 AAGCATCCTCAACCAGATAAGGG - Intronic
1170671197 20:18435178-18435200 AAGCCTCCACTCCCTGCTGATGG - Intronic
1175195960 20:57243590-57243612 AAGGATCCTCACTCTGCTCATGG + Intronic
1175262438 20:57683115-57683137 GAGCAGCCTCTACCTGCTCAGGG - Intronic
1176839417 21:13826955-13826977 AAGCCTCTCCAACCTCCTCAAGG + Intergenic
1178912750 21:36689143-36689165 AAGACTCAACAACCTGCTTATGG + Intergenic
1180995328 22:19962658-19962680 GCCCATCCACAACCTGCTCATGG + Exonic
1181091537 22:20476370-20476392 AAGCACCCACACCCTGCTCAGGG - Intronic
1181107567 22:20584101-20584123 AGGCATTCACAGCCTGATCAGGG + Intronic
952171858 3:30815935-30815957 AAGCATAAATAACATGCTCACGG - Intronic
954678313 3:52327566-52327588 AAGAACCCACCACCTGCTCTGGG + Intronic
954692379 3:52402440-52402462 AGGCAGCCAGCACCTGCTCAAGG - Intronic
955415676 3:58689030-58689052 AAGCATCCTCTCCCTGCTCATGG - Intergenic
958036239 3:88173292-88173314 AGGCATCTTCAACTTGCTCATGG - Intergenic
958077265 3:88696639-88696661 AAACCTCCACATCCTGCACATGG + Intergenic
962459081 3:135592052-135592074 CAGCACCCTCACCCTGCTCATGG + Intergenic
967132321 3:186483676-186483698 AAGCATTCGCAACCTGCTACAGG + Intergenic
967234414 3:187370328-187370350 AAGGATACGCAACCTGCTTAAGG - Intronic
968730130 4:2265603-2265625 CAGGATCCACAAACTCCTCATGG + Intergenic
969223159 4:5774517-5774539 AAGCTTCCTTAACCTACTCAAGG - Intronic
978162879 4:105570526-105570548 AAGCAAACACATCCTTCTCATGG + Intronic
982741250 4:159059839-159059861 GAGCATCCACATCCCTCTCATGG - Intergenic
987237463 5:15957406-15957428 AAGCATCCAAAACCTGCCTAGGG + Intergenic
990609837 5:57445928-57445950 AAGCAGCCTCAACCGGGTCATGG + Intergenic
991593677 5:68280283-68280305 AAGAAACCACAAGCTGTTCAGGG - Intronic
994717241 5:103336286-103336308 CAGAATACACAACCTGCCCAAGG - Intergenic
1000349262 5:160340492-160340514 AAGCATCCCCATCCTACTCTGGG + Intronic
1001315426 5:170638175-170638197 AAGCCTCAACAGCCTGCTCAAGG + Intronic
1001975327 5:175994050-175994072 GATCATCCACAAGCTGCTCTGGG - Intronic
1003291850 6:4786688-4786710 ATGCTCCCACAACCAGCTCAAGG - Intronic
1003625748 6:7739833-7739855 AAGCATCGTCAACATGATCAAGG - Intronic
1005713809 6:28527755-28527777 AAGCTGCCACAAATTGCTCATGG - Intronic
1010015876 6:71104591-71104613 AAACCACCACAACCTGCTGAGGG - Intergenic
1012419504 6:99048284-99048306 GAGCAGCCACAATCTTCTCATGG + Intergenic
1018404856 6:163469007-163469029 AAGAAGCCACAAACAGCTCAAGG - Intronic
1018977458 6:168576071-168576093 GAGCAACCACAACCTGACCAAGG - Intronic
1020435577 7:8158915-8158937 AGGCATTCACAAACTGATCATGG + Intronic
1022965161 7:35465747-35465769 AAGCACCCTCCCCCTGCTCATGG + Intergenic
1023474926 7:40566713-40566735 AAGCATCCACAACCTGCTCACGG - Intronic
1029864323 7:103609949-103609971 AACCATTCACAACCTCTTCAAGG - Intronic
1032204604 7:129850973-129850995 AACCAGCCACATTCTGCTCAGGG + Intronic
1032254057 7:130283123-130283145 AAGGATTCAGAACCTGCACAAGG - Intronic
1033474243 7:141675243-141675265 CAGCATCCACCAGCAGCTCAGGG + Intronic
1033589069 7:142795771-142795793 AAGCATCCCCACCCAGCTCAGGG + Intergenic
1035208432 7:157310003-157310025 GAGCACCCACCACCTGATCAGGG + Intergenic
1039401325 8:37272127-37272149 AAGCATCCCCAACCTGTTGTGGG + Intergenic
1046337042 8:112804129-112804151 AAGCCTCAACAAACTGCTAATGG - Intronic
1046965206 8:120156809-120156831 AAGAAACAATAACCTGCTCAAGG + Intronic
1051357149 9:16250101-16250123 AAGGATCCACAATCTCCTCTGGG - Intronic
1060277060 9:122190597-122190619 AAGCACCCACAAGCTTCTCAAGG - Intronic
1060570702 9:124637031-124637053 AAGCATCAACAAGGTGCTAATGG + Intronic
1062351733 9:136142917-136142939 AAGCATACCCCACCTGCTCAGGG + Intergenic
1188004574 X:25008202-25008224 AGGGATACACAACCTGCTCTTGG + Intronic
1190342067 X:49304521-49304543 CAGCATCGACCTCCTGCTCAAGG - Intronic
1193735930 X:85156388-85156410 AGGCCTCCTCAACCTGATCAAGG + Intergenic
1194175131 X:90636744-90636766 AACCATCCACAACAAACTCACGG + Intergenic
1195634157 X:107094524-107094546 GAGCATCTTCAACCTGCTTATGG + Intronic
1196678830 X:118449877-118449899 AACCATCAACAACATGATCAGGG - Exonic
1196759693 X:119190171-119190193 AAGCATCCAGACCCTGGCCAGGG - Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1200521777 Y:4217717-4217739 AACCATCCACAACAAACTCACGG + Intergenic