ID: 1023476904

View in Genome Browser
Species Human (GRCh38)
Location 7:40590289-40590311
Sequence GAACACTTCAAGGCCAATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 570
Summary {0: 1, 1: 0, 2: 5, 3: 67, 4: 497}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023476904 Original CRISPR GAACACTTCAAGGCCAATAT AGG (reversed) Intronic
901070374 1:6513975-6513997 GAACCCCTCCAGGCCCATATGGG - Intronic
901261139 1:7871936-7871958 GAACACTTAAAGGCTATTGTAGG - Intergenic
903881197 1:26510676-26510698 GAACACTTAGAGGCCACTGTAGG - Intergenic
904443074 1:30544642-30544664 GAACTCTTTAAGTCCAATAATGG + Intergenic
904901890 1:33864292-33864314 GAACTCTTTAAAGCCAACATAGG - Exonic
908975408 1:69891233-69891255 GAACACTTAGAGACCATTATAGG + Intronic
909398363 1:75195888-75195910 GAATACTTCATGGGGAATATAGG - Intergenic
910200452 1:84692886-84692908 GAACACTTAGAGGCCATTGTAGG - Intergenic
910530890 1:88234290-88234312 AAACACCTCAAGGCCAAGATTGG + Intergenic
910801354 1:91149922-91149944 GAACACTTAGAGGCCATTGTAGG + Intergenic
911296620 1:96125275-96125297 GAACACTTGGAGGCCATTTTGGG - Intergenic
911591398 1:99752362-99752384 GAACACTTACAGGCCATTATAGG + Intronic
911755901 1:101556523-101556545 GAACACTTAGAGGCCATTGTAGG + Intergenic
911968516 1:104399139-104399161 GAATACTTACAGGCCAATATGGG + Intergenic
911969892 1:104419242-104419264 GAACACTTAGAGGCCATTGTAGG + Intergenic
912063699 1:105707426-105707448 GGACACTTCAAAGCCAATTTGGG + Intergenic
912731463 1:112110287-112110309 GAACACTTACAGGCCATTGTAGG + Intergenic
912828858 1:112932059-112932081 GAACACTTCAAATACAATTTAGG + Intronic
913934763 1:125025766-125025788 GAGCACTTTGAGGCCTATATTGG + Intergenic
915032171 1:152890261-152890283 GAACACTTAGAGGCCATTGTGGG + Intergenic
915816804 1:158976189-158976211 GAACAAATAAAGGCTAATATTGG + Intronic
916553123 1:165868969-165868991 GAACACTTAGAGGCCATTGTAGG + Intronic
917115371 1:171597840-171597862 GAACACTTAGAGGCCACTGTAGG - Intergenic
917353576 1:174103325-174103347 GAACACTTAGAGGCCATTGTAGG - Intergenic
917766166 1:178219806-178219828 GAACACTTAAATGCCATTGTAGG + Intronic
918130686 1:181625916-181625938 GAACACTTAGAGGCCATTTTAGG + Intronic
918361376 1:183762303-183762325 GAACACTTAGAGGCCATTGTAGG + Intronic
919487868 1:198166529-198166551 GAACACTTGAAGGCCATTGTAGG + Intronic
919548886 1:198959788-198959810 GAACACTTAGAGGCCATTGTGGG + Intergenic
920120487 1:203652900-203652922 GAACACTTAGAGGCCATTGTAGG - Intronic
920635827 1:207702407-207702429 CAACACTTAAAGGCCATTGTAGG - Intronic
921303949 1:213777325-213777347 GAACACTTAGAAGCCACTATAGG + Intergenic
922588653 1:226755295-226755317 GAACACTTAGAGGCCATTGTAGG - Intergenic
922651324 1:227341528-227341550 GAACACTTAGAGGCCATTATAGG + Intergenic
923898290 1:238297087-238297109 GAACACTTAGAGGCCATTGTAGG - Intergenic
923994448 1:239476954-239476976 GGTCACTACAAGGACAATATTGG + Intronic
1063039715 10:2324771-2324793 GAACACTTAGAGGCCATTGTAGG + Intergenic
1063824982 10:9886308-9886330 GAACACTTAGAGGCCACTGTAGG + Intergenic
1065402719 10:25324308-25324330 GAACACTTAGAGGCCATTGTAGG + Intronic
1065546650 10:26828100-26828122 GAACACTTAGAGGCCAACATAGG + Intronic
1066057149 10:31692604-31692626 GAACACTTAGAGGCCATTGTAGG + Intergenic
1066531194 10:36341434-36341456 GAACACTTAGAGGCCATTGTAGG - Intergenic
1066824312 10:39545864-39545886 GAACACTTTAAGGCCTGCATTGG + Intergenic
1067301894 10:45019256-45019278 GAACACTTAGAGGCCATTGTAGG + Intergenic
1067478465 10:46580923-46580945 CAACCCTTCAAGGCCGAGATTGG + Exonic
1067616272 10:47760878-47760900 CAACCCTTCAAGGCCGAGATTGG - Intergenic
1068748720 10:60566303-60566325 GAACATTTAAAGGCCATTGTAGG - Intronic
1068870121 10:61934515-61934537 GAACACTTAGAGGCCATTGTAGG + Intronic
1069417781 10:68216466-68216488 GAACAGTTAGAGGCCAATGTAGG - Intergenic
1069480987 10:68781882-68781904 GAACACTCCAAGGCCATTTTGGG - Intronic
1071662993 10:87524665-87524687 GAACACTTAGAGGCCATTGTAGG + Intronic
1071971190 10:90908769-90908791 GAACACTTAGAGGCCATTGTAGG - Intergenic
1072184822 10:93026871-93026893 GAACACTTAGAGGCCACTGTAGG - Intronic
1072325785 10:94297214-94297236 GAACATTTAGAGGCCAATGTAGG + Intronic
1072667476 10:97404538-97404560 CAACAGTTCAAGACCAATCTGGG + Intronic
1073196633 10:101696440-101696462 GAACACTAAAAGGCCAAGATAGG - Intergenic
1074344814 10:112674442-112674464 GACCTCTTCAAGGCCAGCATGGG + Intronic
1075596518 10:123734198-123734220 GAACACTTAGAGGCCACTGTAGG - Intronic
1076172400 10:128332392-128332414 GAACACTTACAGGCCATTGTAGG - Intergenic
1076513447 10:131028597-131028619 GAACACTTCGAGGCCATGGTAGG - Intergenic
1076856863 10:133120945-133120967 GAACACTTAGAGGCCATTGTAGG + Intronic
1079722393 11:23834400-23834422 GAACATTTAAAGGCCACTGTAGG + Intergenic
1080070606 11:28080699-28080721 GAACACTTGGAGGCCATTTTAGG - Intronic
1080902196 11:36505770-36505792 GAACACTTAGAGGCCATTGTAGG + Intronic
1081062291 11:38494530-38494552 GAACACTTATAGGCCATTGTAGG + Intergenic
1081948366 11:47019484-47019506 GAACACTTAGAGGCCATTGTAGG + Intronic
1082315399 11:50712036-50712058 GAACGCTTTGAGGCCAATAGTGG - Intergenic
1085234047 11:74998023-74998045 GAACACTTAGAGGCCATTGTAGG + Intronic
1085372976 11:76028354-76028376 GAACACTTAGAGGCCATTATAGG - Intronic
1085500530 11:77018436-77018458 GAACACTTAGAGGCCACTGTAGG - Intronic
1085530061 11:77186945-77186967 GAACACTTAGAGGCCATTTTAGG + Intronic
1086323556 11:85675329-85675351 GAACACTTAGAGGCCATTGTAGG + Intronic
1086646964 11:89234584-89234606 GAACACTTAGAGGCCATTTTAGG + Intronic
1086778339 11:90868890-90868912 GAACACTTAAAGGCCATTGAAGG - Intergenic
1087156039 11:94904960-94904982 GAACACTTAGAGGCCATTGTAGG + Intergenic
1087421950 11:97940202-97940224 GAACACTTAAATGCCATTGTAGG - Intergenic
1087488562 11:98791671-98791693 GAACATTTCACTGCCAATAAAGG - Intergenic
1087636005 11:100702190-100702212 GAACACTTGGAGGCCATTGTAGG + Intronic
1087667449 11:101067111-101067133 ACACACTTCAAGGGCAAGATGGG - Intronic
1087913943 11:103786320-103786342 GAACACTTAGAGGCCATCATAGG + Intergenic
1087966098 11:104417939-104417961 GAACACTTAGAGGCCATTGTAGG + Intergenic
1087977361 11:104565674-104565696 GAACACTTAGTGGCCATTATAGG - Intergenic
1088439685 11:109856004-109856026 GAACACTTAGAGGCCAATGTAGG + Intergenic
1088567889 11:111192205-111192227 GAACACTTAGAGGCCATTGTAGG - Intergenic
1089019940 11:115203033-115203055 GAAAACTAAAAGGCCAAAATAGG + Intronic
1089415128 11:118282295-118282317 GAACACTTAGAGGCCATTGTAGG - Intergenic
1089415267 11:118283846-118283868 GAACACTTAGAGGCCATTGTAGG - Intergenic
1092846147 12:12586955-12586977 GCAGACATCAAGGCCAACATGGG - Intergenic
1092878448 12:12868678-12868700 GATCCCTTCAAGGCCATTACTGG - Intergenic
1094632652 12:32191940-32191962 GAACAATTAGAGGCCATTATAGG - Intronic
1095036704 12:37388097-37388119 GAGCACTTTAAGGCCTATGTTGG + Intergenic
1095063015 12:37725291-37725313 GAACACTTTGAGGCCAATGGTGG + Intergenic
1095284746 12:40395621-40395643 GAACACTTAGAGGCCATTGTAGG + Intronic
1095910562 12:47422337-47422359 GAACACTTAGAGGCCAATGTGGG - Intergenic
1096434931 12:51581470-51581492 GAACACTTAGAGGCCACTATAGG - Intergenic
1097276901 12:57819888-57819910 GAACACTTAAGGGCCAATGAAGG + Intergenic
1097788591 12:63789187-63789209 GAACACTTAGAGGGCATTATAGG + Intronic
1098344444 12:69486536-69486558 GAACACTTAGAGGCCATCATAGG - Intronic
1100050200 12:90439425-90439447 GAACACTTGGAGGCTATTATAGG - Intergenic
1100257002 12:92894314-92894336 GAACACTTAGAGGCCATTATAGG - Intronic
1101483175 12:105122924-105122946 GAACACTTAGAGGCCACTGTAGG - Intronic
1103052554 12:117792826-117792848 GAAGACACCAAGGCAAATATTGG + Intronic
1104520631 12:129471566-129471588 GAACACTTAGAGGCCATTGTAGG - Intronic
1105288711 13:19031100-19031122 GAACACTTAGAGGCCACTGTAGG + Intergenic
1105325037 13:19363182-19363204 GAACACTTAGAGGCCACTGTAGG + Intergenic
1105554803 13:21436716-21436738 GAACACTTAGAGGCCATTGTAGG - Intronic
1107041487 13:35952936-35952958 CAACAGTTATAGGCCAATATGGG - Intronic
1107257910 13:38452611-38452633 GAACACTTACAGGCTATTATTGG - Intergenic
1108916667 13:55622407-55622429 GAACACTTAGAGGCCACTGTAGG - Intergenic
1109429691 13:62215434-62215456 AAACACTTCATGGCAAATATTGG - Intergenic
1109586009 13:64405834-64405856 GCACACTTCAAGGAGAAAATTGG + Intergenic
1110680859 13:78310143-78310165 GAAGTCTTCAATGGCAATATTGG - Intergenic
1111163573 13:84427403-84427425 GAACACTTAAAATCCATTATAGG - Intergenic
1111530707 13:89534124-89534146 GAACACTTAGAGGCCACTGTAGG + Intergenic
1112556220 13:100471108-100471130 GAACACTTAGAGGCCACTGTAGG + Intronic
1112623068 13:101071892-101071914 GAACACTTATAGGCCATTGTAGG + Intronic
1113178856 13:107601300-107601322 GAACACTTAAACGCAAATTTGGG + Intronic
1113487019 13:110661726-110661748 GAACACTTAGAGGCCACTGTAGG + Intronic
1113512732 13:110868916-110868938 GAACACTTTCAGGACAATGTGGG - Intergenic
1113648993 13:112020852-112020874 GAACACTTAGAGGCCATTGTTGG - Intergenic
1114001619 14:18257186-18257208 GAACACTTTGAGGCCTATAGTGG - Intergenic
1115043702 14:28962688-28962710 GAACACTTAAAGGCCATTGTCGG + Intergenic
1115468582 14:33744244-33744266 GAACACTTAAAGGCCATGCTAGG + Intronic
1116091673 14:40315640-40315662 GAACACTTAAAGGCCATTGTGGG - Intergenic
1116101243 14:40439679-40439701 GAACACTTAAAGGTCATTGTAGG + Intergenic
1116150624 14:41137142-41137164 GAACACTTAGAGGCCATTGTAGG + Intergenic
1116401165 14:44509021-44509043 GAACACTTAGAGGCCATTGTAGG - Intergenic
1116562155 14:46394060-46394082 GAACACTTAGAGGCCAATGTAGG - Intergenic
1116604897 14:46979361-46979383 GAACACTTAAAGGCCATTGTAGG - Intronic
1116924903 14:50624589-50624611 CAACACTTAAAGGCCATTGTGGG - Intronic
1117263422 14:54060683-54060705 GAACACTTGGAGGCTACTATGGG + Intergenic
1117586953 14:57217672-57217694 GAACACTTAGAGGCCATTGTAGG - Intronic
1118036626 14:61875449-61875471 GAAAACTTCAAGGATATTATTGG + Intergenic
1118176698 14:63447810-63447832 GAACACTTAAAGGCCATTATAGG + Intronic
1118220049 14:63847234-63847256 TAGCACTTCAAGGCCAACCTGGG + Intergenic
1118368942 14:65119748-65119770 GAACACTTCCAGGCCAAGTGTGG + Intergenic
1118413001 14:65502155-65502177 GACCACTTGGAGGCCAACATGGG - Intronic
1118692989 14:68357934-68357956 GAACACTTAGAGGCCATTGTAGG + Intronic
1119308336 14:73625878-73625900 GAACACTTAGAGGCCATTGTAGG - Intergenic
1119883363 14:78119854-78119876 GAACACTTAGAGGCCATTGTAGG + Intergenic
1119979682 14:79065729-79065751 GAAAACATCAAGGCCGAGATTGG - Intronic
1120074325 14:80138510-80138532 GAACACCTCAAGGAGAATTTGGG - Intergenic
1120084497 14:80254704-80254726 GAACACTTAGAGGCCATTTTAGG - Intronic
1122048875 14:99041858-99041880 GAGCAGTTCAAGGCCAATGGAGG + Intergenic
1122170412 14:99869511-99869533 GAACACTTAGAGGCCATTATAGG - Intronic
1122431792 14:101655084-101655106 GAACACTTAAAGGCCATTGTAGG - Intergenic
1122522729 14:102356943-102356965 GTACACTTAGAGGCCAATGTAGG - Intronic
1123226320 15:17036545-17036567 GAGCACTTTAAGGCCTATAGTGG + Intergenic
1124901600 15:33828313-33828335 GAACACTTGGAGGCCACTGTAGG - Intronic
1124950348 15:34313080-34313102 GAAAACTTAGAGGCCAATGTGGG - Intronic
1125000547 15:34765578-34765600 GAACACTTAAAGGCCACTGTAGG + Intergenic
1125236737 15:37523606-37523628 GAACACTTAAAGGCCACCAAGGG + Intergenic
1125367487 15:38933494-38933516 GAACACTTAGAGGCCACTGTAGG + Intergenic
1125651989 15:41324906-41324928 GAACACTTAAAGGCCATTGTTGG + Intronic
1125822739 15:42646873-42646895 GGACACTTAAAGGCCATTGTAGG + Intronic
1125875360 15:43139387-43139409 GAACACTTAGAGGCCATTGTAGG - Intronic
1126307394 15:47275732-47275754 GAATACTTAGAGGCCAATGTAGG - Intronic
1126828245 15:52572346-52572368 GAACACTTAGAGGCCATTGTAGG - Intergenic
1126886022 15:53151169-53151191 GAACACTTAGAGGCCATTGTAGG - Intergenic
1126939368 15:53749541-53749563 GAACACTTAGAGGCCATTATAGG - Intronic
1127307623 15:57723492-57723514 GAACACTTAGAGGCCATTGTAGG - Intronic
1128109722 15:65068531-65068553 TAAGATTTCAGGGCCAATATGGG + Intronic
1128141638 15:65305504-65305526 GAGCATTTCAAGGCCAGTAAGGG - Intergenic
1129106263 15:73309356-73309378 GAACACTGCAAGGGCAATACTGG + Intergenic
1129931700 15:79416587-79416609 GATCTCTTCAAGGCAAATACAGG + Intronic
1130290423 15:82594783-82594805 GAACACTTAGAGGCCATTGTAGG + Intronic
1130301757 15:82684973-82684995 GAACACTTAGAGGCCATTGTAGG + Intronic
1130408137 15:83621350-83621372 GAACACTTAGAGGCCATTGTAGG + Intergenic
1131936014 15:97505848-97505870 GAAGACTTCAAGGCAATTACAGG - Intergenic
1135332170 16:21569692-21569714 GGACTCTTCAAGGCCAACACCGG + Intergenic
1135426401 16:22340489-22340511 CAACACTGCGAGGCCAAGATGGG + Intergenic
1136501522 16:30672343-30672365 GAACACTTAGAGGCCATTGTAGG + Intergenic
1136915638 16:34192781-34192803 GAGCACTTCGAGGACTATATTGG - Intergenic
1137740396 16:50765506-50765528 GAACACTTAGAGGCCATTGTAGG - Intronic
1139059208 16:63228034-63228056 GAACACTTAGAGGCCATTGTAGG + Intergenic
1139840780 16:69877700-69877722 GAACACTTAGAGGCCAATGTAGG + Intronic
1142363973 16:89640140-89640162 GAACCCTTGGAGGCCCATATGGG - Intergenic
1142919003 17:3168099-3168121 CAACACTTAAAGGCCATTGTAGG + Intergenic
1145110573 17:20157870-20157892 CAAGACTTCAAGGCCAGTCTGGG - Intronic
1146115488 17:30134054-30134076 GAACACTTAAAGGCCATTGTAGG + Intronic
1147027927 17:37604786-37604808 GAACACTTAGAGGCCACTGTAGG + Intronic
1148692519 17:49539083-49539105 GAACACTTCAGGTCCATTGTAGG + Intergenic
1149972069 17:61228808-61228830 GAACACTTAGAGGCCATTGTAGG - Intronic
1151243493 17:72776392-72776414 AAAAAATTCAAGGCCAATACTGG - Intronic
1151949336 17:77341271-77341293 GAACACTTAGAGGCCATTGTAGG + Intronic
1153133168 18:1881322-1881344 GAACACTTAGAGGCCATTGTAGG + Intergenic
1153292788 18:3518145-3518167 GAACACATAGAGGCCATTATTGG + Intronic
1153621170 18:6979457-6979479 CAAGAGTTCAAGGCCAATCTGGG + Intronic
1154227657 18:12522001-12522023 GAACACATAAAGGCCATTGTGGG - Intronic
1154249494 18:12731734-12731756 GAACACTTAGAGGCCACTGTAGG + Intergenic
1154667248 18:17284842-17284864 GAGCACTTTCAGGCCAATGTTGG + Intergenic
1154953200 18:21229913-21229935 GAACACTTAGAGGCCATTGTAGG + Intergenic
1155158463 18:23177333-23177355 GAACACTTCAGGGCTTACATGGG - Intronic
1155469974 18:26181451-26181473 GAACACTTAGAGGCCCTTATCGG - Intronic
1155626393 18:27839800-27839822 GAACACTTACAGGCCATTGTAGG - Intergenic
1155824646 18:30424353-30424375 GAACACTTAGAGACCATTATAGG - Intergenic
1158915897 18:62128993-62129015 GGACAATGCAAAGCCAATATTGG + Intronic
1159121192 18:64173493-64173515 GAACACTTAGAGGCCATTGTAGG + Intergenic
1159514486 18:69440045-69440067 GAACACTTAGAGGCCATTGTAGG + Intronic
1159700521 18:71621006-71621028 GAACACTTAGAGGTCAATGTAGG + Intergenic
1164212594 19:23112746-23112768 AAAAACTGGAAGGCCAATATGGG + Intronic
1167397566 19:49241238-49241260 GAACACTGCGAGGCCATTGTAGG + Intergenic
925104189 2:1275673-1275695 GAACACTTCAAGGCCATTCCAGG - Intronic
925360066 2:3272453-3272475 GAACACTCAGAGGCCATTATAGG + Intronic
925854070 2:8112595-8112617 GGACACTTAAAGGCCATTTTTGG - Intergenic
925954291 2:8946891-8946913 GAACACTTAGAGGCCATTGTAGG - Intronic
926805104 2:16701176-16701198 AAAAAATTCAAGGCCAATGTGGG + Intergenic
927299038 2:21489460-21489482 GAACACTTAGAGGCCATTGTAGG + Intergenic
928227183 2:29460779-29460801 GAACACTTAGAGGCCATTGTAGG - Intronic
928720085 2:34110373-34110395 GAACACTTCGAGACCACTGTAGG - Intergenic
929218618 2:39440842-39440864 GAACACAAGAAGGCCAAGATAGG + Intergenic
930831351 2:55746907-55746929 GAACACTTAGAGGTCACTATAGG - Intergenic
930949556 2:57122942-57122964 GAACACTTAGAGGCCATTGTAGG + Intergenic
931279596 2:60777706-60777728 GAACACTTAGAGGCCATTAAGGG + Intronic
931686559 2:64799137-64799159 ACACACTTCAAGCCCAATTTTGG + Intergenic
932469937 2:71948179-71948201 GAACACTTAGAGGCCATTGTAGG + Intergenic
933576057 2:84069586-84069608 GAACACTTTGAGGCCATTGTAGG + Intergenic
933873600 2:86595466-86595488 GAACACTTAGAGGCCATTGTAGG - Intronic
933944544 2:87274337-87274359 GAACACTTAGAGGCCATTGTAGG + Intergenic
934471686 2:94548644-94548666 GAACACTTTGAGGCCTATAGTGG - Intergenic
934548308 2:95237563-95237585 GAACACTTAGAGGCCATTGTAGG - Intronic
934715969 2:96543744-96543766 GAACACTTAAAGACCATTGTAGG - Intronic
936335668 2:111587244-111587266 GAACACTTAGAGGCCATTGTAGG - Intergenic
936551791 2:113449443-113449465 GAACACTTAGAGGCCATTGTAGG + Intronic
937268134 2:120630096-120630118 GAACACTTCAGGGCCAGCCTTGG - Intergenic
938396327 2:130951384-130951406 GAAAACTTAAAGGCCATTACTGG + Intronic
938534626 2:132227341-132227363 GAACACTTTGAGGCCTATAGTGG + Intronic
939498457 2:142950890-142950912 GAACACCTAAAGGCCATTGTAGG + Intronic
939568931 2:143817272-143817294 GAACACTTTAAGTCCAATGAAGG - Intergenic
939601527 2:144198016-144198038 TAAGAGTTCAAGGCCAATCTGGG + Intronic
939931328 2:148237397-148237419 GAACACTTAGAGGCAATTATAGG + Intronic
940184800 2:150972126-150972148 GAACACTTCGAGGCCATTATAGG + Intergenic
940537194 2:154960263-154960285 GAACACTTGGAGGCCATTGTAGG + Intergenic
940685681 2:156847925-156847947 GAACACTTAGAGGCCATTGTTGG - Intergenic
940756636 2:157690417-157690439 GAACACTTAGAGGCCACTGTAGG + Intergenic
940769367 2:157824219-157824241 GCACACTGGAAGGCCAAGATAGG + Intronic
941371308 2:164668354-164668376 GAACACTTAGAGGCCACTGTAGG + Intronic
941488299 2:166110193-166110215 GAACACTTAAAGGCCATTGTAGG - Intronic
942050836 2:172139293-172139315 GAACACTTAGAGGCCATTGTAGG - Intergenic
942110300 2:172675230-172675252 GAACACTTAGAGGCCACTATAGG - Intergenic
942539925 2:177005300-177005322 GAACACTTAGAGGCCATTGTAGG - Intergenic
942876870 2:180810993-180811015 GAACACTTAGAGGCCATTGTGGG - Intergenic
943330896 2:186557927-186557949 GAACGCTTGAAGGCCACTGTAGG + Intergenic
943604861 2:189965082-189965104 GAACAGTTAAAGGCCATTGTAGG + Intronic
944059049 2:195552941-195552963 GAACACTTAGAGGCCATCATAGG + Intergenic
944273964 2:197814541-197814563 GAACATTTAGAGGCCATTATAGG - Intronic
944449275 2:199824631-199824653 GAACACTTAAAGGCCATTGTTGG + Intronic
944720010 2:202414402-202414424 GAACACTTAAAGGCCATTGCAGG - Intronic
945346099 2:208718622-208718644 GAACACTTAGAGGCCATTGTAGG + Intronic
945371770 2:209027205-209027227 GAGCAGTCCAGGGCCAATATTGG + Intergenic
945401008 2:209382765-209382787 GAACACTTCATGTCCCATTTAGG - Intergenic
945442821 2:209900585-209900607 GAACACTTACAGGCCATTGTAGG - Intronic
945493564 2:210483252-210483274 GAACACATAAAGGCCAAGAAGGG + Intronic
946091634 2:217230374-217230396 GAACACTTAGAGGCCATTGTTGG + Intergenic
946464607 2:219900739-219900761 GAACACTTAGAGGTCATTATAGG + Intergenic
946882096 2:224186479-224186501 CAACCCTTCAAGGCCCATGTTGG - Intergenic
947183684 2:227435400-227435422 GAGCAATTCATGGCCAATGTGGG - Intergenic
1169518458 20:6344624-6344646 GAACACTTCGAGGTCATTATGGG + Intergenic
1169836690 20:9888203-9888225 GAAGACTTAAAGGCCATTTTAGG + Intergenic
1170247054 20:14232949-14232971 GAACACTTAGAGGCCATTGTAGG + Intronic
1170642718 20:18169662-18169684 GAACACTTAAAAGCCATTGTAGG - Intronic
1171251281 20:23650612-23650634 AAACACTTAGAGGCCAATGTAGG + Intergenic
1172299451 20:33838884-33838906 GAACCCTGCAAGGCCTATCTGGG - Intronic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1173427444 20:42955438-42955460 GCACAGTTCAAGGACAATGTCGG + Intronic
1174025756 20:47572893-47572915 GAACACTTAGAGACCACTATAGG + Intronic
1174468945 20:50741205-50741227 GAACACTTCGAGGCCAAGACGGG - Intronic
1174652571 20:52140219-52140241 GAACACTTAGAGGCCATTGTAGG - Intronic
1175088369 20:56480679-56480701 GGACACTTAAAGGCCATTGTAGG + Intronic
1175168005 20:57059795-57059817 GAACACTTGGAGGCCAATGTAGG + Intergenic
1176320556 21:5316484-5316506 GAGCACTTTGAGGCCTATATTGG - Intergenic
1176324294 21:5373731-5373753 GAACACTTTGAGGCCTATAGTGG + Intergenic
1176477861 21:7244795-7244817 GAACACCTTGAGGCCTATATTGG - Intergenic
1176477941 21:7246503-7246525 GAGCACTTTGAGGCCTATATTGG - Intergenic
1176482026 21:7307389-7307411 GAACACTTTGAGGCCTATAGTGG + Intergenic
1176760587 21:10781645-10781667 GAACACTTTGAGGCCTATGTTGG + Intergenic
1176763784 21:12993207-12993229 GAACACTTTGAGGCCTATAGTGG - Intergenic
1177286308 21:19055843-19055865 GAACACTTGGAGACCAATGTAGG - Intergenic
1177447857 21:21221276-21221298 GAACACTTAGAGGCCATTGTAGG - Intronic
1177664587 21:24138066-24138088 GGACACTTCAAGGCCATTTTAGG - Intergenic
1178100524 21:29263982-29264004 GAACACTTTGAGGCCATTGTGGG + Intronic
1178938539 21:36885296-36885318 CAACAGTTCAAGGCCAACCTGGG + Intronic
1180426129 22:15187982-15188004 GAACACTTTGAGGCCTATAGTGG - Intergenic
1180503262 22:15959631-15959653 GAACACTTTGAGGCCAATGGTGG - Intergenic
1180651986 22:17385385-17385407 GAACACTTAAAGGCCATTGTAGG + Intronic
1180932569 22:19603145-19603167 GAACACTTAGAGGCCATTGTAGG + Intergenic
1181515803 22:23411563-23411585 GAACACTTAGAGGCCACTGTAGG - Intergenic
1181664047 22:24378604-24378626 GAACACTTAGAGGCCATTGTAGG + Intronic
1182182132 22:28361109-28361131 GAACACTTAGAGGCCATTATAGG - Intronic
1183764530 22:39859498-39859520 GAACACTTAGAGGCCATTGTAGG + Intronic
1185084343 22:48730867-48730889 GAACACTTAGAGGCCACTGTAGG - Intronic
1203330833 22_KI270738v1_random:85762-85784 GAACACTTTGAGGCCTATAGTGG - Intergenic
1203335313 22_KI270739v1_random:62881-62903 GAACACTTTGAGGCCAATGGTGG + Intergenic
949270201 3:2207251-2207273 GAACACTTCAAGGCCATTGGAGG - Intronic
950325917 3:12109939-12109961 CAACTCTCCAAGGCCAAGATGGG + Intronic
950632429 3:14291656-14291678 GAACACTTAGAGGCCATCATTGG - Intergenic
951096788 3:18641650-18641672 TAACACTTAAAGGCCATTATAGG + Intergenic
951373322 3:21880621-21880643 GAACACTTAGAGGCCATTGTAGG - Intronic
952390933 3:32879462-32879484 GAACACTTAGAGGCCATTGTAGG + Intronic
953121678 3:40049610-40049632 GAACACTTAGAGGCCATTATAGG - Intronic
953837963 3:46363588-46363610 GAACACTTAGAGGCCATTGTAGG - Intergenic
954373202 3:50180509-50180531 GAACACTTAGAGGCCATTGTGGG + Intronic
954944611 3:54409472-54409494 GAACACTTAGAGGCCACTGTAGG - Intronic
956150032 3:66231229-66231251 GAACACTCCAAGGTCTATAGAGG + Intronic
956332238 3:68124329-68124351 GAAAACTTCCTGGCTAATATGGG + Intronic
956960630 3:74396145-74396167 GAACACTTAGAGGCCATTGTAGG - Intronic
956960761 3:74397597-74397619 GAACACTTAGAGGCCATTGTAGG - Intronic
957115763 3:76023421-76023443 GAACACTTACAGGCCATTGTAGG + Intronic
957779371 3:84798752-84798774 AAACACCTCACGGCTAATATAGG - Intergenic
958201444 3:90321582-90321604 GAACACTTTTTGGCCAGTATTGG - Intergenic
958204114 3:90367017-90367039 GAGCACTTTGAGGCCTATATTGG - Intergenic
958661626 3:97076057-97076079 GAACACTTAAAGGCCACTGTAGG - Intronic
960657370 3:120020670-120020692 GAACACTTAGAGGCCACTGTAGG - Intronic
961092158 3:124122805-124122827 GAACACTTAGAGGCCACTGTAGG - Intronic
961396323 3:126594074-126594096 GAACACTTAGAGGCCACTGTAGG + Intronic
962028927 3:131578462-131578484 GAACACTTAGAGGCCATTGTAGG - Intronic
962157418 3:132962875-132962897 GAATACTTAGAGGCCAATGTAGG + Intergenic
962461380 3:135616688-135616710 GAACACTTAGAGGCCATTGTAGG + Intergenic
964217682 3:154305521-154305543 CAACACTTTGAGGCCAAGATGGG + Intronic
964535021 3:157711343-157711365 GAACACTTAAAGACCATTGTAGG - Intergenic
965438692 3:168685800-168685822 GAACACTTAGAGGCCATTGTAGG - Intergenic
965604097 3:170482595-170482617 GGCCACTTCATGGCCAATGTAGG + Intronic
966065835 3:175820578-175820600 GAACACTTAGAGGCCATTGTAGG + Intergenic
966214314 3:177486334-177486356 AAACACTTAGAGGCCAATGTAGG + Intergenic
966368211 3:179214325-179214347 GAACACTTAGAGGCCATTGTAGG + Intronic
966633212 3:182102272-182102294 GAACACTTAGAGGCCATTGTAGG + Intergenic
967086635 3:186100708-186100730 GAACACTTCAAGGGGAAAATGGG + Intronic
967545211 3:190717911-190717933 GAACACTTAGAGGCCATTTTAGG + Intergenic
967725048 3:192854054-192854076 GAACACTTAGAGGCCACTGTAGG - Intronic
967766565 3:193286728-193286750 GAACACTTAGAGGCCACTGTGGG - Intronic
970884616 4:20973703-20973725 GAACACTTAGAGGCCATTGTAGG + Intronic
971167978 4:24203863-24203885 GAACACTTCAAAGCACCTATAGG - Intergenic
971618162 4:28820523-28820545 AAATACTTCAAAGCAAATATTGG + Intergenic
971857857 4:32065326-32065348 AAAAACTTGAAGGCCAAAATAGG + Intergenic
971918228 4:32903522-32903544 GAACACATAAAGGCCATTGTAGG + Intergenic
972624332 4:40781391-40781413 GAATACTTGAAAGTCAATATTGG + Intronic
972954673 4:44374656-44374678 GAACACTTAAAGGCCACTATAGG + Intronic
974105363 4:57463748-57463770 CAACCCATCAAGGCAAATATTGG - Intergenic
974212085 4:58791179-58791201 GAACACTTAGAGGCCATTGTAGG - Intergenic
974816937 4:67017178-67017200 GAAGACTTGGAGGCCACTATGGG + Intergenic
975133759 4:70853889-70853911 GAACACTTAGAGGCCACTGTAGG - Intergenic
975407654 4:74009814-74009836 GAACACTTTGAGGCCATTGTAGG - Intergenic
975567916 4:75779275-75779297 GAACACTTAGAGGCCACTGTAGG - Intronic
975686537 4:76921440-76921462 GAACACTTAGAGGCCATTGTAGG + Intergenic
975880085 4:78894851-78894873 GAACACTTAGAGGCCATTGTGGG + Intronic
977314349 4:95426430-95426452 GAACACTTAGAGGTCATTATAGG - Intronic
977365221 4:96059336-96059358 GGACACTTCAAAGTCATTATAGG + Intergenic
977539345 4:98297750-98297772 GAACACTTACAGGCCACTGTAGG - Intronic
977688336 4:99874839-99874861 GAACACTTAGAGGCCATTTTAGG + Intergenic
977852860 4:101850982-101851004 GAACACTTGGAGGCCATTGTAGG - Intronic
977887129 4:102265213-102265235 GAACACTTAGAGGCCACTGTAGG + Intronic
978134410 4:105239879-105239901 GAACACTTAGAGGCCACTGTAGG + Intronic
978212113 4:106149437-106149459 GAACACTTTGAGTCCATTATAGG + Intronic
978343703 4:107743171-107743193 GAATACTTCATGGGCAGTATAGG - Intergenic
978686302 4:111448437-111448459 GAACACTTAGAGGCCATTGTAGG + Intergenic
979307739 4:119167008-119167030 GAACACTTAGAGGCTACTATAGG - Intronic
980221325 4:129919711-129919733 GAACACTTAGAGGCCATTGTAGG - Intergenic
980298996 4:130963919-130963941 GAACACTTAGAGGCCATTGTAGG - Intergenic
980314392 4:131178010-131178032 GTACAGCTCAAGGCCAACATTGG + Intergenic
980529482 4:134033381-134033403 GAACACTTAAATGTCATTATAGG - Intergenic
981421317 4:144553905-144553927 GAACAATTCAAGGATAAAATTGG + Intergenic
981628685 4:146791593-146791615 GAACACTTAGAGGCCAGTGTAGG - Intronic
981764525 4:148233317-148233339 GAACACTTAGAGGCCATTGTTGG + Intronic
981995318 4:150967956-150967978 GAACACTTAGAGGCCATTGTAGG - Intronic
982021725 4:151211415-151211437 GAACACTTAGAGGCCACTGTAGG - Intronic
982344629 4:154343966-154343988 GGACACTTAAAGGCCATTATAGG + Intronic
983052476 4:163064916-163064938 GTACACTTTTAGGCAAATATTGG + Intergenic
983073745 4:163299866-163299888 GAACACTTAGAGGCCATTTTAGG + Intergenic
983086685 4:163453864-163453886 GAACACTTGGAGGCCTTTATAGG + Intergenic
984174492 4:176399394-176399416 GAACACTTAGAGGCCAATGTAGG - Intergenic
984193065 4:176627281-176627303 GAACACTTCATTGCCCAGATAGG - Intergenic
984258594 4:177416941-177416963 GAACACTTAGAGGCCATTATAGG + Intergenic
984899127 4:184569116-184569138 GAACACTAAAAGGCCATTGTAGG + Intergenic
985188329 4:187342985-187343007 GAACACTTAGAGGCCATTGTGGG + Intergenic
985900449 5:2785034-2785056 GAACACTTAAAGGCCATTGTAGG - Intergenic
986825776 5:11520656-11520678 CCACAATTCAAGGCCAATCTAGG - Intronic
987919960 5:24266893-24266915 GAACACTTAGAGGCCATTGTAGG - Intergenic
988655535 5:33207381-33207403 GAACACTTAGAGGCCAAAGTAGG - Intergenic
988669755 5:33368762-33368784 GAACACTTAGAGGCCATTGTAGG + Intergenic
989001075 5:36761436-36761458 GAACACTTAGAGGCCATTATAGG + Intergenic
989287812 5:39722597-39722619 GAACACTTAGAGGCCATTGTAGG + Intergenic
989762063 5:45027721-45027743 GAACACTTAGAGGCCATTGTAGG - Intergenic
989858261 5:46328493-46328515 GAACACTTTGAGGCCTATGTTGG - Intergenic
990523165 5:56599444-56599466 GAACACTTAGAGGCCATTGTAGG + Intronic
990887499 5:60611390-60611412 GAACACTTAGAGGCCATTGTAGG - Intronic
991191805 5:63883220-63883242 GAACACTTAAAGACCATTTTAGG + Intergenic
991366853 5:65877512-65877534 GAACACTTAAAGACCATTGTAGG - Intergenic
992074568 5:73179112-73179134 GAACACTTAGAGGCCATTGTAGG - Intergenic
992127926 5:73661613-73661635 GAACACTTAGAGGCCATTGTAGG + Intronic
992918332 5:81482945-81482967 GAACACTTAGAGGCCATTTTAGG + Intronic
992935624 5:81701149-81701171 GAACACTTAGAGGCCATTGTAGG + Intronic
993082145 5:83314900-83314922 GAACACTTAGAGGCCATTGTAGG - Intronic
993151286 5:84165498-84165520 GAATCCTTCAAGAGCAATATTGG - Intronic
993906439 5:93629090-93629112 GAACACTTAGAGGCCATTGTAGG + Intronic
994760974 5:103853678-103853700 GAACACTTACAGGCCATTGTAGG + Intergenic
994827724 5:104736543-104736565 GAAAACTTAAAGGACATTATAGG + Intergenic
995001602 5:107137914-107137936 GAACACTTAGAGGCCATTGTAGG + Intergenic
995291474 5:110461035-110461057 AAACACTTAAAGGCCATTGTGGG - Intronic
996512500 5:124332720-124332742 GAACACTTAGAGGCCACTGTAGG + Intergenic
996526375 5:124484517-124484539 GAACACTTAGAGGCCATTGTAGG + Intergenic
997176225 5:131780836-131780858 GAACACTTAGAGGCCATTGTGGG - Intronic
997505968 5:134417222-134417244 CAACACCTCAAAGCAAATATGGG - Intergenic
997703458 5:135924045-135924067 GAACACTTAGAGGCCATTCTAGG + Intronic
998863669 5:146472647-146472669 GAACACTTTGAGGGCATTATAGG - Intronic
999514926 5:152291492-152291514 GAACACTTAGAGGCCACTGTAGG - Intergenic
999575864 5:152975952-152975974 GAACACTTAGAGGCCACTGTAGG - Intergenic
999801193 5:155038718-155038740 GAACACTTGAAGGCCATTGTAGG + Intergenic
999835138 5:155362108-155362130 GAACACTTAAAGGCTATTGTAGG + Intergenic
1000312585 5:160059563-160059585 GAACACTTAAAGGTCATTACAGG + Intronic
1000389248 5:160705934-160705956 GAACACTTAGAGGCCATTGTAGG + Intronic
1000662098 5:163949778-163949800 GAACTCTTAAAGGCCAAAACAGG - Intergenic
1000758250 5:165187378-165187400 GAACACTTAGAGGCCATTGTAGG - Intergenic
1000886699 5:166755816-166755838 GAACACTTAGAGGCCACTGTAGG - Intergenic
1001434552 5:171689004-171689026 GAAGACTTCATGGCCCAGATGGG + Intergenic
1001479766 5:172080326-172080348 GAACACTTAGAGGCCATTGTAGG - Intronic
1003187731 6:3847825-3847847 GAACACTTAGAGGCCATTGTAGG + Intergenic
1003275046 6:4643284-4643306 GAACACTTAGAGGCCACTGTAGG + Intergenic
1003706096 6:8532093-8532115 GAACACTTAGAGGCCATTGTAGG - Intergenic
1003822898 6:9919845-9919867 GAACACATAGAGGCCAATGTAGG - Intronic
1003996165 6:11541798-11541820 GAACACTCAGAGGCCAATGTAGG + Intronic
1004922805 6:20392799-20392821 GAACACTTAAAGGCTATTATAGG + Intergenic
1005790746 6:29297096-29297118 GAATACTTAAAGGCCATTGTAGG - Intergenic
1006298191 6:33179326-33179348 GAACACTCCGAGGCCACTGTTGG - Intronic
1007223684 6:40298083-40298105 GAACACTTCATGGCCAAGGATGG - Intergenic
1008030699 6:46689908-46689930 GTGCACTTCACAGCCAATATTGG - Exonic
1008268898 6:49466041-49466063 GAACACTTAGAGGCCATTGTAGG + Intronic
1008831620 6:55770747-55770769 GAACACTTTTAGGCCATTGTCGG + Intronic
1010021120 6:71161145-71161167 AAACACCTCAATGGCAATATGGG - Intergenic
1010288844 6:74112121-74112143 GAACACTTAGAGGCCATTGTAGG - Intergenic
1010566076 6:77415855-77415877 GAACACTTAGAGGCCAGTGTAGG + Intergenic
1010964338 6:82186245-82186267 GAACACTTAGAGGCCACTGTAGG - Intronic
1011060692 6:83263303-83263325 GAACACTTAAAGGCTATTGTGGG - Intronic
1011069810 6:83367995-83368017 GAACACTTAAAGGCCATTGCAGG + Intronic
1011115677 6:83888687-83888709 GAACACTCAGAGGCCAATGTAGG - Intronic
1011218043 6:85026166-85026188 GAACACTTAGAGGCCATTGTGGG - Intergenic
1011482649 6:87810579-87810601 GTACACTTCAAGGTTCATATGGG - Intergenic
1011587887 6:88946446-88946468 GAACACTTAGAGGCCATTGTAGG - Intronic
1012284478 6:97372243-97372265 GAACACTTATAGGCCATTGTAGG - Intergenic
1013030876 6:106331436-106331458 GAACACTTAGAGGCCATTATAGG - Intergenic
1013324235 6:109028432-109028454 GAACACTTTAAGGTCAAATTTGG - Intronic
1013712889 6:112921917-112921939 GAACACTTAGAGGCCACTGTAGG - Intergenic
1013814443 6:114080992-114081014 GAACACTTAGAGGCCATTGTAGG + Intronic
1013943595 6:115695417-115695439 GAACACTTAGAAGCCACTATAGG - Intergenic
1014319616 6:119910617-119910639 AAACACTTCGAGGCCATTGTAGG - Intergenic
1014833123 6:126126119-126126141 GAAAACTTCAATGCCCATAAAGG - Intergenic
1015230440 6:130909211-130909233 GAGCTCTTCAAGGACAATAATGG + Intronic
1015760355 6:136653051-136653073 GAAGACTGCAAGGCCTATAAAGG + Intronic
1016794076 6:148099079-148099101 GAACACTTAGAGGCCATTGTAGG - Intergenic
1016903279 6:149123256-149123278 GAACACTTAGAGGCCATTGTAGG - Intergenic
1017734688 6:157350558-157350580 GAACACTTAGAGGCCATTATAGG - Intergenic
1018164096 6:161077586-161077608 GAACAGTTCAAGGCCATTCCAGG + Intronic
1018224167 6:161611715-161611737 GAACACTTGGAGGCCATTGTAGG - Intronic
1018843624 6:167538235-167538257 GAACACTTTGAGGCCACTGTGGG + Intergenic
1019035618 6:169054757-169054779 GAAAACTTAGAGGCCATTATAGG + Intergenic
1020859780 7:13477144-13477166 GAACACTTAGAGGCCATTGTAGG + Intergenic
1021267963 7:18548074-18548096 GAACACTTAGAGGCCATTGTAGG + Intronic
1021472220 7:21017009-21017031 GGACACTTAAAGGCCATTGTAGG + Intergenic
1021934098 7:25613252-25613274 GAACACTTAGAGGCTAATGTAGG + Intergenic
1022279905 7:28897288-28897310 GAACACTTAGAGGCCATTGTAGG + Intergenic
1022674960 7:32490581-32490603 CAAAACTTCAAGGGCATTATGGG - Intronic
1023292471 7:38682804-38682826 GAACACTTCCAGGTTAATCTTGG + Intergenic
1023476904 7:40590289-40590311 GAACACTTCAAGGCCAATATAGG - Intronic
1023645336 7:42306694-42306716 GAACACTTAAAGTCCACTGTAGG - Intergenic
1023710254 7:42985149-42985171 GAACACTTACAGGCCATTGTAGG + Intergenic
1025017763 7:55453464-55453486 GAACACTTATAGGCCATTGTAGG + Intronic
1025569506 7:62541617-62541639 GAACAATTTAAGGCCAATGGTGG + Intergenic
1026507737 7:71000134-71000156 GAACACTTAGAGGCCATTGTAGG - Intergenic
1027006050 7:74693880-74693902 GAACACTCAGAGGCCACTATAGG - Intronic
1028037701 7:86005227-86005249 GAACACTTGGAGGCCATTGTTGG + Intergenic
1028870537 7:95766768-95766790 GAACACTTAGAGGCCACTGTAGG - Intergenic
1029049893 7:97674762-97674784 GAACACTTAAAGGCTATTATAGG - Intergenic
1030098722 7:105925341-105925363 GAACAGTTAGAGGCCATTATAGG + Intronic
1030491300 7:110238335-110238357 GAACACTTAGAGGCCATTGTAGG - Intergenic
1030499788 7:110345101-110345123 GAACACTTCAGGGTCATTGTGGG + Intergenic
1030664856 7:112265270-112265292 GAACACTTAAAGGCCATTGTAGG + Intronic
1031511337 7:122653954-122653976 GAACACTTACAAGCCATTATTGG - Intronic
1031654857 7:124342193-124342215 GAACACTTAGAGGCCATTGTAGG + Intergenic
1031698301 7:124888962-124888984 GAACACTTATAGGCCATTATAGG - Intronic
1032180874 7:129676416-129676438 GAACACTTAGAGGCCATTGTAGG + Intronic
1032622405 7:133549335-133549357 GAACACTTAGAGGCCATTGTAGG + Intronic
1033119165 7:138651857-138651879 GAACACTTAGAGACCACTATAGG - Intronic
1033439074 7:141362357-141362379 GTACACTTCAAAGCCAAAACAGG - Intronic
1035387095 7:158480469-158480491 GAACACTTAGAGGCCACTGTAGG - Intronic
1036469123 8:9034689-9034711 GAACACTTAGAGGCCACTGTAGG - Intronic
1036724233 8:11205127-11205149 GAACACCTCAATTCCAATATGGG + Intergenic
1036735692 8:11313577-11313599 GAACACTTACAGGCCATTGTAGG + Intronic
1037263385 8:17033103-17033125 GAACACTTAGAGGCCATTCTAGG - Intronic
1037303736 8:17482497-17482519 GAACACTTAGAGGCCGATGTAGG - Intergenic
1037481658 8:19311857-19311879 GAAGAGTTCATGGCAAATATAGG + Intergenic
1038392889 8:27221484-27221506 GAACACTTAGAGGCCATTGTAGG + Intergenic
1039701774 8:39969523-39969545 GAACACTTAGAGGCCATTGTAGG - Intronic
1040133002 8:43819446-43819468 AAACCCTTTAAGGCCAATAGGGG + Intergenic
1040459800 8:47636388-47636410 GAACACTTCGAGGCCACTGGAGG - Intronic
1040737273 8:50523465-50523487 GAACACTTAGAGGCCATTGTAGG + Intronic
1041131285 8:54704258-54704280 GAACACTTAGAGGCCATTATAGG + Intergenic
1041622033 8:59982785-59982807 GAACACTTAGAGGCCATTGTAGG + Intergenic
1041847875 8:62352407-62352429 AAGCACTTCAAGTCTAATATTGG - Intronic
1042045529 8:64647060-64647082 GAACACTTAAAGGCCACTGTAGG + Intronic
1042548024 8:69968147-69968169 GAACACTTAGAGGCCATTGTAGG - Intergenic
1042686734 8:71450325-71450347 GAACACTTAGAGGCCATTGTAGG + Intronic
1042795460 8:72658032-72658054 GAACACTTAGAGGCCATTGTAGG - Intronic
1043201508 8:77375007-77375029 GAACACTTAAAGGCCAATGTAGG + Intergenic
1043722475 8:83562940-83562962 GAACACTTAGAGGCCATTGTAGG + Intergenic
1044259606 8:90102244-90102266 GAACACTTAGAGGCCATTATAGG + Intergenic
1046534110 8:115486402-115486424 GAACACTTAAAGGCTACTGTAGG - Intronic
1047777739 8:128087553-128087575 GAGCTTTTCAAGGCCAATAATGG - Intergenic
1049901210 9:167709-167731 GAACACTTACAGGCCATTGTAGG - Intronic
1050206918 9:3206185-3206207 GAACACTTCATGGCTACTTTTGG + Intergenic
1050298704 9:4234326-4234348 GAATACTTAAAGGCCATTCTAGG + Intronic
1050349583 9:4727851-4727873 GAACACTTAGAGGCCACTGTAGG + Intronic
1050699474 9:8322219-8322241 GAACACTTAGAGGCCATTGTAGG - Intronic
1050755481 9:8997635-8997657 GAACACTTTGAGGCCATTATAGG - Intronic
1051064395 9:13084905-13084927 GAACACTTAGAGGCCATTGTAGG - Intergenic
1051542968 9:18241255-18241277 GAACACTTAGAAGCCATTATAGG + Intergenic
1051568924 9:18533931-18533953 CAACCCTTCAAATCCAATATGGG - Intronic
1051967928 9:22851722-22851744 GAACACTTAGAGGCCACTGTAGG + Intergenic
1052543286 9:29838804-29838826 GAACACTTAGAGGCCATTGTAGG + Intergenic
1053250337 9:36568852-36568874 GAACACTTAGAGGCCATTGTAGG - Intergenic
1053744249 9:41178023-41178045 GAACACTTAGAGGCCATTGTAGG - Intronic
1053938654 9:43201330-43201352 GAACACTTTGAGGCCAATAGTGG + Intergenic
1054077242 9:60547992-60548014 GAACACTTTGAGGCCAATAGTGG - Intergenic
1054349526 9:64007921-64007943 GAACACTTAGAGGCCATTGTAGG - Intergenic
1054421788 9:64942176-64942198 GAACACTTCAAGGCCTATGGTGG + Intergenic
1054422264 9:64951669-64951691 GAACACTTTGAGGCCTATAGTGG + Intergenic
1054483021 9:65687175-65687197 GAACACTTAGAGGCCATTGTAGG + Intronic
1054684095 9:68253230-68253252 GAACACTTAGAGGCCATTGTAGG + Intronic
1055150688 9:72995335-72995357 GAACACTTAAAGCCCATTGTAGG - Intronic
1055189966 9:73506678-73506700 GAACACTTCAAGGACATTGTAGG - Intergenic
1055402396 9:75938218-75938240 GAACACTTAGAGGCCATTGTAGG + Intronic
1055838253 9:80471490-80471512 CAGCACTTCAATGCCAATGTTGG - Intergenic
1057240273 9:93401634-93401656 GAACACTTAGAGGCCACTGTGGG - Intergenic
1057543236 9:95995951-95995973 GAACAATTAAAGGCCATTGTAGG - Intronic
1058196381 9:101981886-101981908 GAACAATTAAAGGCCATTGTAGG - Intergenic
1058641706 9:107093436-107093458 GAACACTTAGAGGCCATTGTGGG + Intergenic
1058780079 9:108324756-108324778 GTACACTTCAAAGGCTATATAGG + Intergenic
1059156615 9:111995030-111995052 GAACACTTAGAGGCCATTGTAGG + Intergenic
1059572497 9:115454703-115454725 GAACACTTAGAGGCCATTGTAGG + Intergenic
1059844293 9:118255341-118255363 GAACACTTAGAGGCCATTGTAGG - Intergenic
1060938943 9:127532347-127532369 GAACTTTTCAAGGCCAAGGTAGG + Intronic
1061494593 9:130964897-130964919 GAACTCTTAGAGGCCATTATAGG - Intergenic
1203381240 Un_KI270435v1:46689-46711 GAACACTTTAAGGCCTATGGTGG + Intergenic
1203375246 Un_KI270442v1:368151-368173 GACCACTTTGAGGCCAATGTTGG + Intergenic
1203398537 Un_KI270519v1:53703-53725 GAACACTTTGAGGCCTATGTTGG + Intergenic
1186622329 X:11254497-11254519 GAACACTGCAAGTCAAATATTGG - Intronic
1186942329 X:14523610-14523632 GAATACTTGAAGGCCATTGTAGG + Intergenic
1187026664 X:15442427-15442449 GAACACATCGAGGCCATTGTGGG - Intronic
1187506953 X:19886620-19886642 GAAGACTTAAAGGACAGTATGGG + Intronic
1188231087 X:27664031-27664053 GAACACTTAGAGGCCATTGTAGG - Intronic
1188238057 X:27752969-27752991 GAACACTTAGAGGCCATTGTTGG - Intergenic
1188292498 X:28406462-28406484 GAATGCTTCAGGGCCAATCTTGG - Intergenic
1188448228 X:30280052-30280074 GAACACTTAAAGGCCACTATAGG - Intergenic
1188540567 X:31245892-31245914 GAACACTTAGAGGCCATTGTAGG - Intronic
1189263694 X:39697139-39697161 GAACACTTAAAGGCCACTGTAGG + Intergenic
1189768497 X:44396660-44396682 GAACACTTGAAGGCCATAGTAGG - Intergenic
1191773821 X:64790678-64790700 GAACACTTAGAGGCCATTGTAGG - Intergenic
1191779106 X:64847604-64847626 GAACACTTCCAGGGGAAGATTGG + Intergenic
1192388629 X:70700617-70700639 GAACACTTAGAGGCCATTGTAGG - Intronic
1192701082 X:73474107-73474129 GAACACTTAGAGGCCATTACAGG + Intergenic
1193012641 X:76694661-76694683 GAACACTTAGAGGCCATTTTAGG - Intergenic
1194364724 X:93000771-93000793 GAACACTTAGAGGCCATTATAGG - Intergenic
1194580386 X:95664792-95664814 GAACACTTAAAGGTCATTGTAGG - Intergenic
1196578021 X:117343815-117343837 GAACACTTACAGGCCATTGTAGG + Intergenic
1198542910 X:137659234-137659256 GAACACTTAGAGGCAATTATAGG - Intergenic
1198621347 X:138514180-138514202 GAACACTTAGAGGCCATTGTAGG + Intergenic
1199145100 X:144356167-144356189 GAACACTTAGAGACCATTATAGG + Intergenic
1199195625 X:145026638-145026660 GATCTCTTCAGGGCCAATGTTGG - Intergenic
1199543866 X:148986745-148986767 AAACACTTGATGTCCAATATTGG - Intronic
1199623406 X:149718764-149718786 GAGAACTTCAAGGCAAATGTGGG + Intergenic
1200672952 Y:6117032-6117054 GAACACTTAGAGGCCATTATAGG - Intergenic
1200956499 Y:8953407-8953429 GAACTCTTCAAAGTCAATGTTGG - Intergenic