ID: 1023477143

View in Genome Browser
Species Human (GRCh38)
Location 7:40593057-40593079
Sequence GCGGCTGGTAGGACACAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023477134_1023477143 19 Left 1023477134 7:40593015-40593037 CCAGGGCCTAGGAGAAAAGCATA 0: 1
1: 0
2: 2
3: 15
4: 214
Right 1023477143 7:40593057-40593079 GCGGCTGGTAGGACACAAAGGGG 0: 1
1: 0
2: 0
3: 7
4: 70
1023477135_1023477143 13 Left 1023477135 7:40593021-40593043 CCTAGGAGAAAAGCATAGCTTTG 0: 1
1: 0
2: 2
3: 35
4: 369
Right 1023477143 7:40593057-40593079 GCGGCTGGTAGGACACAAAGGGG 0: 1
1: 0
2: 0
3: 7
4: 70
1023477133_1023477143 24 Left 1023477133 7:40593010-40593032 CCAGACCAGGGCCTAGGAGAAAA 0: 1
1: 0
2: 1
3: 18
4: 195
Right 1023477143 7:40593057-40593079 GCGGCTGGTAGGACACAAAGGGG 0: 1
1: 0
2: 0
3: 7
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023477143 Original CRISPR GCGGCTGGTAGGACACAAAG GGG Intronic
909937898 1:81574937-81574959 GCAGCTGGAAGTACACACAGAGG - Intronic
910124850 1:83829412-83829434 GCAGCAGGCAGGACAAAAAGGGG - Intergenic
1070525495 10:77292619-77292641 GGGCCTGGAAGGACAAAAAGAGG - Intronic
1075093151 10:119454566-119454588 GTGGCTGGGAGGATACAATGGGG - Intronic
1075799144 10:125141997-125142019 GGGGCTGGTGGGACACAGTGTGG + Intronic
1077361149 11:2140596-2140618 GCGGCTGGAGGGTCCCAAAGTGG - Intronic
1078355147 11:10627442-10627464 GCTGCTGGTTGGAGACAAGGGGG - Intronic
1084323443 11:68385971-68385993 GGGGCTGGCAGGAGACAAGGGGG + Intronic
1086472514 11:87130506-87130528 GGGGATGGCAGGACACAAGGAGG - Intronic
1089324472 11:117647868-117647890 GGGGTTGGTGGGGCACAAAGGGG - Intronic
1090954753 11:131504166-131504188 GTGGCTGGTGGGGCTCAAAGGGG - Intronic
1090991399 11:131820122-131820144 GCGGCTGCTTGGGCGCAAAGTGG + Intronic
1091048870 11:132349932-132349954 GCTGCTGGAATCACACAAAGGGG + Intergenic
1096261746 12:50097040-50097062 GCAGCTGGTAGGAGACCCAGAGG + Intronic
1099347084 12:81515242-81515264 GTAGCTGGTAGGAAAGAAAGGGG - Intronic
1108849310 13:54707810-54707832 GCTGTTGGTGGGACAAAAAGGGG - Intergenic
1110795318 13:79630272-79630294 CCTGCTGGTAGGACTCAAACTGG - Intergenic
1111916285 13:94364220-94364242 GCAGCTTGTAGGAGACTAAGAGG + Intronic
1112102367 13:96203286-96203308 GCGGCTGGTAAACCAGAAAGAGG - Intronic
1113517033 13:110911472-110911494 GCGCCTGGCATTACACAAAGTGG - Intronic
1113728593 13:112623958-112623980 GGGGATTGTAGGACAGAAAGGGG + Intergenic
1117776345 14:59188625-59188647 TCGCCTGATAGGATACAAAGTGG - Intronic
1128660119 15:69493966-69493988 GCTGCTGAAAGGACACAAATTGG - Intergenic
1133224999 16:4336903-4336925 GCTGCTCGTGGGACACAAAGTGG - Exonic
1133277318 16:4646793-4646815 GGGGCTTCTTGGACACAAAGTGG + Intronic
1134309449 16:13062445-13062467 GTGGCAGGTAAGACACAGAGAGG - Intronic
1136246502 16:28979241-28979263 TCCGCTGGTCGGCCACAAAGAGG - Exonic
1139613717 16:68076454-68076476 GCTGCTGGTAGGACAAGAATGGG + Intronic
1141197845 16:81874733-81874755 GCAGGTGGTTAGACACAAAGAGG - Intronic
1143387464 17:6540182-6540204 GGGGCTGGTAGGCATCAAAGGGG + Intronic
1145065258 17:19757540-19757562 TCGGCTGGTAGGAGAAAAATGGG + Intergenic
1155658116 18:28214860-28214882 GAAGCTGGGAGGACACAAATAGG + Intergenic
1156299912 18:35827133-35827155 GGGGCTGGTACTACAAAAAGGGG + Intergenic
1157830702 18:50854660-50854682 GAGGCTGGTAGGTAATAAAGAGG + Intergenic
1158693749 18:59684548-59684570 GAGGCTGGCAAAACACAAAGTGG - Intronic
1162962293 19:14135585-14135607 GGGACTGGTGGGACACAAATGGG + Intronic
932719870 2:74131024-74131046 GGGGCTGGTAGGGGATAAAGAGG + Intronic
936084167 2:109455228-109455250 GCGGCTGGCAGGAGACCATGAGG + Intronic
938711311 2:133978252-133978274 GCTGTTGGTGGGACACAAGGAGG + Intergenic
942389454 2:175477062-175477084 GGGGCTGGTAGGATGAAAAGAGG + Intergenic
944556474 2:200892204-200892226 GCGGATGGTAGGAGAGAATGAGG - Exonic
947356598 2:229302454-229302476 GCAGCTGGTAGAAGAGAAAGTGG + Intergenic
948732170 2:239973144-239973166 GCAGGTGGCAGGGCACAAAGTGG + Intronic
1172189562 20:33053845-33053867 GCGGCTCTGAGGACACAAAGGGG - Intergenic
1173749933 20:45469144-45469166 GGGGCCGGTAGGACAAAGAGAGG + Intergenic
1175100244 20:56574325-56574347 GGGGCAGGGAGGACAGAAAGAGG - Intergenic
1179792105 21:43761701-43761723 AGGGCTGGTGGGACAAAAAGAGG + Exonic
1179944953 21:44666869-44666891 GCAGCTGGTATGACACATGGTGG + Exonic
1181082258 22:20423490-20423512 GCAGCTGGCAGGACACAAACAGG - Intergenic
955927641 3:64023436-64023458 GCGGCTGACAGGACACAACTTGG + Exonic
962813402 3:138977774-138977796 GCTGCCATTAGGACACAAAGAGG - Intergenic
964460097 3:156914980-156915002 GAGGATGGATGGACACAAAGAGG - Intronic
968152677 3:196350298-196350320 GCAACTGGTAGGCCACAAAGAGG + Exonic
968232599 3:197012489-197012511 TCGACTGGAAGGCCACAAAGAGG - Intronic
968442460 4:630798-630820 GGGGCTGGTGAGACACAAAGAGG + Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969438874 4:7205654-7205676 GGGGCTGGTTGAAAACAAAGAGG + Intronic
969657981 4:8508973-8508995 GCAGCTGGCAGGACTCAGAGAGG + Intergenic
980642818 4:135601958-135601980 GCAGCTTGTAGGAAACAAAAAGG + Intergenic
985783190 5:1881426-1881448 GGGGCTGGGAGGACAGGAAGAGG + Intronic
985983594 5:3491890-3491912 TCTTCTGGTAGGAGACAAAGGGG - Intergenic
986766077 5:10928268-10928290 GTGACTGGTAGCACACACAGAGG - Intergenic
991258159 5:64638014-64638036 GCATGTGGTAGGACACAAAGGGG + Intergenic
992218644 5:74549749-74549771 GGGGCAGGTGGGACAGAAAGGGG - Intergenic
994949347 5:106438342-106438364 GTTGATGTTAGGACACAAAGTGG - Intergenic
999295922 5:150459371-150459393 GCGGCAGGCAGGGCACACAGAGG - Intergenic
1004421411 6:15473529-15473551 GTGGGTGGCAGGACACAAAGCGG - Intronic
1021836847 7:24685400-24685422 GTGGGTGGGAGGAAACAAAGTGG - Intronic
1023477143 7:40593057-40593079 GCGGCTGGTAGGACACAAAGGGG + Intronic
1027925987 7:84464276-84464298 GCGACTTGCAGAACACAAAGTGG + Intronic
1034718048 7:153261952-153261974 GAGGATGGAAGGAAACAAAGAGG + Intergenic
1044520798 8:93197198-93197220 GAGGCTAGTGGGACACAGAGAGG + Intergenic
1053031857 9:34787082-34787104 GGGGCTGGAAGGAAGCAAAGGGG + Intergenic
1059453786 9:114387274-114387296 GGGGCAGGGAGGACACAGAGAGG - Intronic
1061028978 9:128068340-128068362 GCGGCGGGGAGGCCACACAGCGG - Exonic
1061265107 9:129500326-129500348 AGGGCTGGTGGAACACAAAGGGG + Intergenic
1186482189 X:9904499-9904521 GGGGCTGCTGGGAAACAAAGGGG - Intronic
1192326393 X:70135730-70135752 GGTGATGGTAGAACACAAAGAGG + Intronic