ID: 1023478648

View in Genome Browser
Species Human (GRCh38)
Location 7:40608716-40608738
Sequence CTATTGTACTAAAGTACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023478648_1023478649 30 Left 1023478648 7:40608716-40608738 CCTTTTGTACTTTAGTACAATAG 0: 1
1: 0
2: 0
3: 12
4: 180
Right 1023478649 7:40608769-40608791 TTTTACCAATGAGCCAAAAATGG 0: 1
1: 0
2: 3
3: 36
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023478648 Original CRISPR CTATTGTACTAAAGTACAAA AGG (reversed) Intronic
907379257 1:54072333-54072355 TTATTGAAATAAAGAACAAATGG - Intronic
908580830 1:65514799-65514821 ATATTGGACTCAAGTATAAAAGG - Intronic
909407199 1:75304800-75304822 CCATTGTACTAAGTTAAAAATGG + Intronic
909928380 1:81465754-81465776 TTATAGTACTAAAGAATAAATGG + Intronic
910074226 1:83258414-83258436 TTATTGTAATAAATTAAAAATGG - Intergenic
911421883 1:97653095-97653117 TTATTGTAGTGACGTACAAAGGG - Intronic
911659012 1:100478757-100478779 CTATTGTAATAAAGTAGAACAGG - Intronic
918666408 1:187155920-187155942 CTAATGTAGTAAAATAAAAAAGG - Intergenic
919380895 1:196859476-196859498 CTATTATATGTAAGTACAAATGG + Intronic
920887174 1:209940366-209940388 CTATTGTACAAAAAAAAAAAAGG - Intronic
921005145 1:211085829-211085851 CTATTGTCCAAAAGGCCAAATGG + Intronic
921232903 1:213091482-213091504 GTAATGTAACAAAGTACAAAAGG - Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921598720 1:217083839-217083861 CTATAGTACTATAGTAAACATGG - Intronic
1064491481 10:15861638-15861660 GTATTATACTAAAATACAACTGG - Intergenic
1064521345 10:16205719-16205741 CTTCTGTACTACAGAACAAATGG - Intergenic
1068618817 10:59154995-59155017 TTATTGTAAAAAAGTATAAAAGG + Intergenic
1070277863 10:75024962-75024984 CTTTTGTACTAAAGAAGAAAAGG + Exonic
1071883117 10:89920912-89920934 CTCTTGTACTATAATACAGAAGG - Intergenic
1073802803 10:107061502-107061524 CTCTTGTACTGTAGTATAAATGG - Intronic
1075359783 10:121820887-121820909 TTATTGTACTAAATTGTAAAAGG + Intronic
1076430086 10:130395588-130395610 CTGTTGTTCTAAAGAACAAAAGG + Intergenic
1077959504 11:7059477-7059499 CTATTGTACAAAAGCAATAATGG + Intronic
1079251130 11:18788954-18788976 CTATTACGCTAACGTACAAAAGG + Intronic
1079638161 11:22771408-22771430 CTTTTGCATTAAACTACAAATGG - Intronic
1079861185 11:25673536-25673558 GTATTTTATTAAACTACAAATGG - Intergenic
1082025960 11:47572549-47572571 CTATAGAACAAAAGTACAATTGG + Exonic
1084418318 11:69047485-69047507 CTATTTTATTAAAGAAGAAAAGG + Intergenic
1086211048 11:84319222-84319244 CTATTGATCTAAAATAAAAAGGG - Intronic
1087571995 11:99940369-99940391 CTAATGAACTAAAGTAAAACTGG + Intronic
1088279540 11:108122089-108122111 CTATTGTATTAAAAAAGAAAAGG - Intronic
1092623564 12:10301196-10301218 CTAGGGTACTAAGCTACAAATGG - Intergenic
1093556710 12:20484650-20484672 CTAACGTAATAAAGAACAAAAGG - Intronic
1093986933 12:25544620-25544642 ATATAGTAATAAAGGACAAAAGG - Intronic
1094462425 12:30711412-30711434 ATGTAGTACTAAAGTACTAAGGG - Intronic
1097655356 12:62354926-62354948 TTATTGTAATAGAGTAAAAATGG - Intronic
1099711827 12:86236492-86236514 CTATTGTCCTAAATTAATAAAGG + Intronic
1099777598 12:87152697-87152719 CTATAGTACTGTAATACAAAGGG - Intergenic
1100144762 12:91664162-91664184 CTTTTGAATTAAAATACAAAGGG + Intergenic
1101015182 12:100493168-100493190 ATAGTTTACGAAAGTACAAATGG - Intronic
1102769799 12:115465608-115465630 CTATTGTACTAATAAGCAAATGG + Intergenic
1105510100 13:21044264-21044286 CTATGGTAATAAACTACAAGAGG + Intronic
1108732392 13:53248423-53248445 CTTTTGTAATAAATTAGAAATGG + Intergenic
1109083255 13:57934989-57935011 CTATTCTAAAAAAGTTCAAATGG + Intergenic
1109116047 13:58387107-58387129 TTACTGTGCTTAAGTACAAATGG + Intergenic
1109789925 13:67231897-67231919 CTATTGTACTCAAAAACAAGGGG - Intergenic
1112684427 13:101807349-101807371 ATTTTCTACTAAAGTAGAAAGGG + Intronic
1112959997 13:105112396-105112418 GTATTTGACAAAAGTACAAAGGG + Intergenic
1115126051 14:29995222-29995244 CTCTTATACTAGAGTAGAAATGG - Intronic
1115808014 14:37074081-37074103 ATATTTTACTTAAGAACAAAAGG + Intronic
1116919315 14:50556069-50556091 TTAAAGTACTAAAGTTCAAATGG + Intronic
1117375847 14:55117604-55117626 CTTTTTTTTTAAAGTACAAAGGG + Intergenic
1119495924 14:75079131-75079153 CTATTTTACTAAGTAACAAATGG + Exonic
1121384236 14:93502685-93502707 CTTTTGTCCTATAGTTCAAATGG - Intronic
1124239233 15:28016432-28016454 TTAGTGTACAAAAGTACAAAAGG + Intronic
1125009135 15:34851322-34851344 CCAGTGAACTAAAGTAGAAAAGG + Intergenic
1126364953 15:47884611-47884633 CTATTGTACTATGGTACAATCGG - Intergenic
1126364954 15:47884612-47884634 CGATTGTACCATAGTACAATAGG + Intergenic
1127070526 15:55284295-55284317 TTATTGTACCAAAATAAAAAGGG + Intronic
1131527787 15:93166429-93166451 CTATTGTACTAATGAAGAAATGG + Intergenic
1131935668 15:97501619-97501641 CTATTGTACAGAAGCAGAAAGGG - Intergenic
1133604200 16:7370108-7370130 CAATTGTCCTACAGTACACAGGG - Intronic
1144522708 17:15964718-15964740 CTATGGTACCAAACTATAAAAGG - Intronic
1144527326 17:16000783-16000805 GTATGGTCCTAAAGTGCAAATGG - Intronic
1149189204 17:54038384-54038406 CTAATGTACTGAACTAGAAATGG - Intergenic
1151017132 17:70568313-70568335 TTATTGTACTAAAGTACTGTTGG + Intergenic
1152171379 17:78751384-78751406 CTATTGTTCCTAAGTACAAGAGG - Intronic
1153143940 18:2007076-2007098 CTATAGTACTATAGTATATATGG + Intergenic
1155037901 18:22040741-22040763 CTTTATTGCTAAAGTACAAAGGG - Intergenic
1155657841 18:28211602-28211624 CCATTATACCAAAGCACAAAAGG - Intergenic
1155875715 18:31085030-31085052 TTAACGTAATAAAGTACAAAAGG + Intronic
1156069687 18:33192134-33192156 CAACTGTACATAAGTACAAATGG - Intronic
1156838854 18:41587557-41587579 CTATTGGGATAAAGTAAAAAGGG - Intergenic
1159554186 18:69928201-69928223 CTATTCTACTTAATTACATATGG + Intronic
1159989364 18:74884629-74884651 ATATTGTAATAAATTATAAATGG - Intronic
1166592402 19:44011646-44011668 CTAGTGTTCTAAAGCACCAAAGG - Exonic
1166594428 19:44033183-44033205 CTATTGTTCTATAGCACTAAAGG - Intergenic
927922109 2:26981022-26981044 CTATTTTACTAAAGAAAGAAAGG - Intronic
928368855 2:30724165-30724187 TAATTGTAATAAAATACAAATGG - Intronic
928791228 2:34956579-34956601 ATATTGTAATAAAGTCCTAATGG + Intergenic
929296258 2:40250801-40250823 ATATTGTGCTAAAGTACACTGGG - Intronic
929953663 2:46437780-46437802 CTCTTGTTCTAAAGTATCAATGG - Intronic
930233092 2:48862376-48862398 TGATTGTACTAAAGACCAAACGG - Intergenic
930343152 2:50143321-50143343 CTAATGTGCTTAAGTACAGAGGG + Intronic
930354692 2:50303013-50303035 TTTTTGAACTAAAGTCCAAAAGG + Intronic
930982026 2:57537846-57537868 CTCTTTTACTAAACCACAAAAGG - Intergenic
931022585 2:58065897-58065919 ATATACTACTAATGTACAAATGG - Intronic
931377581 2:61721248-61721270 CTATATTACTTAAATACAAAAGG - Intergenic
931838787 2:66127627-66127649 CTCATGTTCCAAAGTACAAAGGG - Intergenic
932145116 2:69309298-69309320 CTATGGAACTGAAGCACAAAAGG - Intergenic
938421523 2:131151184-131151206 GTAATGTAATAAAGGACAAATGG - Intronic
938557970 2:132443297-132443319 CAATATTACTAAAGTACAGATGG + Intronic
940207253 2:151216639-151216661 GTAGTGTACTAAAGTCCACATGG - Intergenic
942478430 2:176354574-176354596 CTATATTACAAAAGTAGAAAGGG - Intergenic
942526031 2:176853873-176853895 CTATTATTCTAAAGGGCAAAAGG + Intergenic
943337408 2:186634155-186634177 CTATTGTACATATGTTCAAATGG - Intronic
943528802 2:189052609-189052631 CAACTGTACTATAGTGCAAAGGG - Intronic
944470932 2:200053602-200053624 CTAGTTTACTTGAGTACAAAGGG + Intergenic
945344396 2:208695797-208695819 CTATTGTAATAAAAAATAAAAGG + Intronic
945806317 2:214494043-214494065 CTAATTTTCTAAAGTTCAAAAGG + Intronic
1170758262 20:19224259-19224281 CTTTTGTACTAAAAGACACATGG - Intronic
1170815457 20:19709907-19709929 CTATTGTACTAAATGACTAAAGG + Intronic
1171724131 20:28600230-28600252 CTACTGTGCTAAAGAATAAATGG + Intergenic
1171753928 20:29082803-29082825 CTACTGTGCTAAAGAATAAATGG - Intergenic
1171788315 20:29494724-29494746 CTACTGTGCTAAAGAATAAATGG + Intergenic
1171859235 20:30379791-30379813 CTACTGTGCTAAAGAATAAATGG - Intronic
1174526894 20:51179565-51179587 CTTTTGTATTAAAATACAAAAGG + Intergenic
1176709629 21:10138063-10138085 CAATTGTCCTAAACTCCAAATGG - Intergenic
1178848284 21:36191872-36191894 CTATTGTGGTAAAATACACATGG + Intronic
1180297683 22:10958905-10958927 CTACTGTGCTAAAGAATAAATGG + Intergenic
1180410743 22:12604880-12604902 CTACTGTGCTAAAGAATAAATGG - Intergenic
1181799569 22:25335736-25335758 CTATCTTACTAAAATACAAAAGG - Intergenic
952369629 3:32709112-32709134 TTAATGTACTAAAGTAAGAAAGG - Intronic
953714368 3:45304918-45304940 ATATTGTTCTCAAGTACACATGG + Intergenic
953777914 3:45838878-45838900 CTAAGGTACTCAAGTACAACAGG + Intronic
954947431 3:54438850-54438872 ATATTCTACCAAAGTAAAAATGG - Intronic
955460965 3:59182880-59182902 CTATTGTTCAAAAGTAGCAATGG - Intergenic
957622755 3:82615889-82615911 CTCTTGTATTAAAATACCAATGG + Intergenic
957801799 3:85094003-85094025 CTATTACACTAGTGTACAAATGG - Intronic
957851764 3:85817221-85817243 CAAGTGGACTGAAGTACAAATGG + Intronic
958723505 3:97875606-97875628 CTCTTGTATTAAATTTCAAATGG + Exonic
960778964 3:121296280-121296302 GTATTCTACTAAAGTACTCAGGG - Intronic
963921349 3:150909014-150909036 CTATAGCACCAAAGAACAAAGGG - Intronic
965233528 3:166085240-166085262 CTGCTGTACGAAAGTACAACAGG + Intergenic
966180642 3:177185436-177185458 TTTTTGTACTTAAGTAGAAATGG - Intronic
974501468 4:62709887-62709909 CTATTGTACCAAGGTAAAAAGGG + Intergenic
974880033 4:67744035-67744057 CCATTTTACTAAAGCAAAAAAGG + Intronic
976946828 4:90780731-90780753 CCATTTTAATAAAGTAAAAAGGG - Intronic
977092607 4:92697335-92697357 CCAATGTACAAAAGTACAAGGGG + Intronic
977183122 4:93902519-93902541 CTATTGTGATACAGTGCAAAGGG - Intergenic
977203429 4:94143355-94143377 CTATTGTACTTTAGACCAAATGG + Intergenic
980040637 4:127935670-127935692 GCACTGTTCTAAAGTACAAATGG - Intronic
980803079 4:137778212-137778234 CTATTCAACTAAACCACAAATGG + Intergenic
983754537 4:171318743-171318765 CTATTGTAAGAAAAAACAAATGG - Intergenic
984331758 4:178329747-178329769 CTATTGTGGAAAAGTACAAGTGG + Intergenic
984536542 4:180982949-180982971 CTATTGTTCTAAAATACATCTGG + Intergenic
985118269 4:186613729-186613751 CAATTTTACCAAAATACAAAAGG + Intronic
985249135 4:188005593-188005615 TATTTGTACTAATGTACAAAGGG + Intergenic
986937867 5:12913862-12913884 ATATTGTAGTAAAATAAAAATGG + Intergenic
992058857 5:73021462-73021484 CTAAAGTACTAAAGGAAAAAAGG - Intronic
993432780 5:87852238-87852260 CTATTGTACTAACTTTCTAAAGG + Intergenic
994240391 5:97412572-97412594 GTTTTGTACTAAATTACGAAAGG - Intergenic
996617108 5:125455159-125455181 CTACTGTACTAATTTACAGAAGG + Intergenic
996917330 5:128727912-128727934 CTATTACACAAAAGTAAAAATGG - Intronic
997169521 5:131702063-131702085 CAATTGTGCAAAAGTAGAAATGG + Intronic
997461598 5:134056393-134056415 CAATTGTAAAAAAGTAAAAAAGG - Intergenic
998271138 5:140707785-140707807 ATTTTGTACAAAAGTCCAAAGGG - Intergenic
1000984527 5:167852513-167852535 CTATTTAACTAAAGAAGAAACGG + Intronic
1004946610 6:20621095-20621117 CAATTGTACTTAAATGCAAATGG - Intronic
1006973972 6:38079303-38079325 ATATTACAGTAAAGTACAAATGG - Intronic
1007053746 6:38860209-38860231 TCATTGCAATAAAGTACAAAGGG - Intronic
1009318001 6:62247470-62247492 GAATTGTACTAAAGTAACAATGG + Intronic
1010360306 6:74986007-74986029 CTATTGTAACACAGTACCAAGGG - Intergenic
1010384112 6:75259179-75259201 CTAATGTACTAAAATTCTAAAGG - Intronic
1010614855 6:78000291-78000313 CTATTGTGCTAGATTACATATGG + Intergenic
1010935569 6:81857039-81857061 CAATTATACTCAAGTCCAAAGGG + Intergenic
1013295990 6:108758910-108758932 TTTTTGTATTAAAGTAGAAATGG + Intergenic
1014623934 6:123703128-123703150 GTATTGTGTTATAGTACAAATGG - Intergenic
1016918775 6:149270408-149270430 CTCTTGAACTAAAGAAAAAAAGG - Intronic
1020349669 7:7204971-7204993 ATATTGTTCTCAAGTACACAGGG - Intronic
1020733644 7:11917523-11917545 ATATTGTTGTAAAGGACAAAGGG - Intergenic
1022613765 7:31906804-31906826 CTATTTTACCAAAGAAGAAATGG - Intronic
1023306542 7:38835278-38835300 AAATTGTTCTAAAGTAAAAAGGG - Intronic
1023478648 7:40608716-40608738 CTATTGTACTAAAGTACAAAAGG - Intronic
1027291922 7:76723275-76723297 TTATTGTAATAAATTAAAAATGG - Intergenic
1028624328 7:92861401-92861423 CTATTGTATAAAACTATAAAAGG + Intergenic
1028960413 7:96742822-96742844 GTATTCTTTTAAAGTACAAATGG + Intergenic
1030484231 7:110146250-110146272 CTATTGAACTAATTTTCAAAAGG + Intergenic
1031332039 7:120477498-120477520 CTATTGTAAAAAATTACAAAGGG + Intronic
1032514873 7:132499460-132499482 CTCTGGAGCTAAAGTACAAAAGG - Intronic
1036413440 8:8524647-8524669 CTATTGTAGAAAACTACAACTGG + Intergenic
1042576148 8:70221260-70221282 CTATTTAACTAAACTACAGAAGG + Intronic
1044428531 8:92082253-92082275 GAATGATACTAAAGTACAAATGG - Intronic
1045566255 8:103319142-103319164 CTGTTGAGCTAAAGTACGAAGGG + Intronic
1045630866 8:104119912-104119934 TTACTGTCCTTAAGTACAAATGG - Intronic
1046089522 8:109483860-109483882 ATATTTTAATAAAGTATAAATGG + Intronic
1046328455 8:112680514-112680536 ATAATGGACTAAAGTAAAAAGGG - Intronic
1050935019 9:11385595-11385617 CCATTGTAGTACAGTACCAAGGG - Intergenic
1052682146 9:31707088-31707110 CATTTATACTAAAGTACAAAGGG + Intergenic
1053237808 9:36471386-36471408 CTATTCTACCAAATTTCAAAAGG + Intronic
1053725473 9:40994839-40994861 CTACTGTGCTAAAGAATAAATGG - Intergenic
1054340469 9:63857038-63857060 CTACTGTGCTAAAGAATAAATGG + Intergenic
1056598822 9:88030001-88030023 CTATTGTAACAAAGTACAGCAGG + Intergenic
1059576714 9:115497235-115497257 CTCTTGTACTATTTTACAAAAGG + Intergenic
1202794388 9_KI270719v1_random:107030-107052 CAATTGTCCTAAACTCCAAATGG - Intergenic
1203449339 Un_GL000219v1:97132-97154 CTACTGTGCTAAAGAATAAATGG + Intergenic
1187798280 X:23029229-23029251 CTTTTGTACAAAAGTACAGTTGG + Intergenic
1192828336 X:74723077-74723099 CTAGTGTTCTATAGTACAATAGG + Intergenic
1193848414 X:86504102-86504124 ATAATGTAATAATGTACAAAAGG - Intronic
1194709930 X:97223130-97223152 GTTTTGTCTTAAAGTACAAAAGG + Intronic
1195266516 X:103186081-103186103 TTATTATACTAAAGCACACAAGG - Intergenic
1196612056 X:117726731-117726753 GTATTTTAATAAATTACAAATGG - Intergenic
1197710560 X:129663814-129663836 ATATTGTACTAAAATTTAAAAGG + Intergenic