ID: 1023485034

View in Genome Browser
Species Human (GRCh38)
Location 7:40677173-40677195
Sequence AGGTTCCAACTCTTTCTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023485034_1023485037 8 Left 1023485034 7:40677173-40677195 CCAAACAGAAAGAGTTGGAACCT 0: 1
1: 0
2: 0
3: 16
4: 131
Right 1023485037 7:40677204-40677226 GATGTCCTATCTCTTTCATTCGG 0: 1
1: 0
2: 1
3: 10
4: 158
1023485034_1023485039 26 Left 1023485034 7:40677173-40677195 CCAAACAGAAAGAGTTGGAACCT 0: 1
1: 0
2: 0
3: 16
4: 131
Right 1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG 0: 1
1: 0
2: 0
3: 7
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023485034 Original CRISPR AGGTTCCAACTCTTTCTGTT TGG (reversed) Intronic
902345803 1:15816463-15816485 AGGTTCCATCTCTTTATTCTGGG + Intergenic
906302707 1:44695128-44695150 GGATTCTAACTCTTACTGTTAGG - Intronic
906491067 1:46269061-46269083 GGCTTCCATCTTTTTCTGTTTGG + Intronic
908597639 1:65705597-65705619 AGGTTTCACCTCTGTCTGGTGGG + Intergenic
909363454 1:74792404-74792426 AGTTTTCAATTCTTTCTTTTTGG - Intergenic
912380216 1:109243486-109243508 AGGTTCCATCTCTTCCTGCCCGG + Intergenic
913179646 1:116309245-116309267 AGGATCCAACTCTCTCAGTGGGG - Intergenic
914407176 1:147387992-147388014 AGTTTCCAACTCATTCTATGAGG - Intergenic
917042251 1:170818360-170818382 TGGTTCCAACTCTTCCCTTTTGG - Intergenic
917271771 1:173283297-173283319 AGGTTTCAACTCTCTTTTTTGGG - Intergenic
917466246 1:175279128-175279150 AGGTTCAACCTCTGTCTGTGAGG - Intergenic
918151440 1:181800571-181800593 AGGTTCCATCTGTTCCTGGTGGG - Intronic
919236122 1:194844865-194844887 ACGTTCCAAATCTTTCTTCTAGG + Intergenic
919378786 1:196828441-196828463 AGGTTCCAACTCTTTTAATTTGG - Intronic
923771535 1:236942072-236942094 AGGTCCCACCTCTTTGTGTTAGG + Intergenic
924113297 1:240721680-240721702 ATTTTCCAACTCTTAATGTTAGG - Intergenic
1065413952 10:25463965-25463987 AGGTTCCTTCTCATTCTGTGAGG + Intronic
1066194960 10:33090197-33090219 AGATTGTAATTCTTTCTGTTTGG + Intergenic
1067708736 10:48631311-48631333 AGTTTCTAACTCATTCTGTGAGG - Intronic
1068217528 10:54002232-54002254 AGTTTCCAGCTATTTTTGTTTGG - Intronic
1068462739 10:57349006-57349028 AGTTTCCAACTATTACTGTGTGG + Intergenic
1070694927 10:78555415-78555437 AGCTTCCAATTCTTTCTGATGGG + Intergenic
1072245889 10:93543456-93543478 AGGTGCTAACTCTTTCTCCTCGG - Intergenic
1072515244 10:96175429-96175451 AGGTACTAACTCTGTCAGTTGGG + Intronic
1073849874 10:107602481-107602503 AGGTTCTGTCTCTTTCTGTCAGG + Intergenic
1074231245 10:111538052-111538074 AGTTTCAGACTCTTACTGTTTGG + Intergenic
1082094856 11:48121464-48121486 AAGTTCTAACTACTTCTGTTTGG + Intronic
1087564551 11:99837391-99837413 TGGTTCCAAAACTTTCTGTATGG - Intronic
1088283689 11:108163955-108163977 ATGTTTCAACTTTTCCTGTTTGG - Intronic
1089516386 11:119034828-119034850 AGTTTCCAACAAATTCTGTTGGG - Intergenic
1089808208 11:121110846-121110868 AGGTGAGAACTCTTTCTGTGAGG + Intronic
1091836926 12:3592595-3592617 AGCTTCCAGCTCTTCCTGTGAGG + Intronic
1094574597 12:31673605-31673627 ACTTTCCAACTCTTTCTGTGAGG + Intronic
1099901763 12:88719339-88719361 AGTTTTCTACTATTTCTGTTTGG + Intergenic
1105697695 13:22905625-22905647 ACTTCCCAACTCTTTCTGTGAGG + Intergenic
1105765397 13:23554032-23554054 AGGGTCCATGTCTTTCTGTTTGG + Intergenic
1106936435 13:34726920-34726942 AATTTCCAACTCTTTCTATGAGG + Intergenic
1107334700 13:39342305-39342327 AGGGTCCAAACCTTTCTCTTTGG + Intergenic
1107818644 13:44266829-44266851 AGGCTCCACTTCTTTCTGTGTGG - Intergenic
1109057952 13:57576363-57576385 AGGTTCCATCTGTTTATTTTTGG + Intergenic
1112523924 13:100124939-100124961 ATTTTCAAACTTTTTCTGTTTGG + Intronic
1113162817 13:107401668-107401690 AAGTAACAACTATTTCTGTTGGG - Intronic
1114057615 14:18986641-18986663 AATTTGCATCTCTTTCTGTTTGG + Intronic
1114104931 14:19415113-19415135 AATTTGCATCTCTTTCTGTTTGG - Intronic
1116567101 14:46461737-46461759 AGTTTCCAAGTCTTTCTTTTAGG - Intergenic
1126571102 15:50151713-50151735 AGGTTCTCACTCTGTCTCTTAGG - Intronic
1130852490 15:87808785-87808807 ATGATCCAACTTTTTCTGTAAGG - Intergenic
1130871573 15:87976190-87976212 CTGTTCCAACTCTTTCTCCTTGG + Intronic
1132080132 15:98856644-98856666 TGGTTCCAATTCTTTATATTTGG - Intronic
1133846476 16:9458593-9458615 AGGGTCTCACTCTGTCTGTTGGG - Intergenic
1141296743 16:82776781-82776803 AGCTCCCATCTCTTTCTGGTGGG - Intronic
1143271384 17:5678056-5678078 AGTTTCCAAATCTTTAAGTTTGG - Intergenic
1153152761 18:2113191-2113213 AGGTTTCAACTCTTACAATTAGG - Intergenic
1155702996 18:28772018-28772040 AGTTTCACAATCTTTCTGTTTGG - Intergenic
1158149395 18:54350489-54350511 AGGTCCCAACTATTTATTTTTGG + Intronic
1164818951 19:31229262-31229284 ATGTTTCTAATCTTTCTGTTTGG - Intergenic
1168431048 19:56280862-56280884 AGTTTCCAACACATGCTGTTTGG + Intronic
926751231 2:16200201-16200223 AGGTCCCAGCTGTTTCTGGTGGG + Intergenic
927270499 2:21204458-21204480 AGGTGTCAACTCCTTTTGTTGGG + Intergenic
929141078 2:38667041-38667063 AGGTCCCCACTCTTGCGGTTTGG + Intronic
930026347 2:47031484-47031506 AGATTCTAAATCTTTCTGCTTGG - Intronic
932305825 2:70703613-70703635 TATTTCCAACTTTTTCTGTTAGG - Intronic
934536287 2:95136660-95136682 AAGTTCCATAACTTTCTGTTAGG - Intronic
935794745 2:106630264-106630286 AGGTTCCTTCTCTTTCAGTTGGG + Intergenic
938284683 2:130101236-130101258 AATTTGCATCTCTTTCTGTTTGG - Intronic
938335322 2:130489790-130489812 AAATTGCATCTCTTTCTGTTTGG - Intronic
938354501 2:130630876-130630898 AATTTGCATCTCTTTCTGTTTGG + Intronic
938430923 2:131237656-131237678 AATTTGCATCTCTTTCTGTTTGG + Intronic
939901133 2:147850912-147850934 AGTTTCCAATTCTTTCCCTTAGG - Intronic
940790607 2:158026652-158026674 AGGTTTGAACTCTTTCTGTGTGG - Intronic
941956324 2:171208731-171208753 AGTTTACAACTCATTCTCTTGGG + Intronic
945657393 2:212642109-212642131 AAGTTCCAACTATTTATCTTTGG + Intergenic
945896911 2:215493674-215493696 AAGTTCCTTTTCTTTCTGTTGGG - Intergenic
946460778 2:219866440-219866462 AGATTCTAACTCTATCAGTTAGG + Intergenic
947732038 2:232436688-232436710 CTGTTCCATCTCTTTCTGTGTGG - Intergenic
948625195 2:239264216-239264238 AGGCTTCACCTCTTTCTGCTCGG + Intronic
1168947126 20:1770465-1770487 AGGAAGCAACTCTTTCTGTAGGG + Intergenic
1170712949 20:18808531-18808553 AGGCTCCAGCTCATTATGTTGGG + Intergenic
1173019181 20:39253088-39253110 AAGTTAGAACTCTTTCTGTTGGG - Intergenic
1180476102 22:15709254-15709276 AATTTGCATCTCTTTCTGTTTGG + Intronic
1185282343 22:49978846-49978868 AGGTGCCAAGGCTTTCAGTTGGG - Intergenic
949749200 3:7331337-7331359 ATCTTCCAGCTCTGTCTGTTAGG - Intronic
950897989 3:16470672-16470694 AGCTGCCAACTCTGTCTCTTGGG - Intronic
954869139 3:53754042-53754064 AGGGTCAAATTCTTTCTGATGGG - Intronic
956367356 3:68519000-68519022 ATGTATCAACTCATTCTGTTTGG - Intronic
956498578 3:69855969-69855991 AGCTTCCCACTTTTTCTGTATGG + Intronic
960622469 3:119650198-119650220 AGGTTCACAGTCTTTGTGTTTGG - Intronic
964187113 3:153959365-153959387 ACGTTCCAACTCTTCTAGTTCGG + Intergenic
970348978 4:15181817-15181839 AGTTTCCAACACTTCCTGCTTGG - Intergenic
971535648 4:27747427-27747449 ATGGACCAACTCTTTCTGCTAGG + Intergenic
973781960 4:54296498-54296520 AGTTTCAAACTCTTTCTCTTTGG - Exonic
975413578 4:74083065-74083087 ACGTTCCTCCTCTTTCTTTTGGG + Intergenic
977230033 4:94440862-94440884 AGTTTCAAACTCTTTCTTGTCGG - Intergenic
978116480 4:105025247-105025269 AGGGTAAAACTCTTTCTGCTTGG + Intergenic
978230331 4:106389777-106389799 AGGTTCCATAACTTTCTGTTGGG + Intergenic
978894133 4:113866404-113866426 AGGTCCCTTCTATTTCTGTTGGG - Intergenic
980612290 4:135174566-135174588 ACGTTCCTCCTCTTTCTTTTGGG - Intergenic
980905687 4:138946573-138946595 AGGTTCCAGCTGATTCTGTTTGG - Intergenic
983632678 4:169865050-169865072 AGCCTCCAATTCTTTCTGTAAGG + Intergenic
986272314 5:6244020-6244042 ATGTTCCTACTCTTTCTCTGTGG - Intergenic
988910107 5:35831063-35831085 GGTTTCCAATTCTTTCTCTTTGG + Intergenic
989243866 5:39231388-39231410 GGGTTACAAAGCTTTCTGTTAGG + Intronic
991394368 5:66188368-66188390 ACTTTCCAACTCATTCTATTAGG - Intergenic
992004678 5:72465717-72465739 TTGTTTCAACTCTTTCTGGTGGG - Intronic
998429795 5:142060993-142061015 AAGTTCCATCTCTTGCTCTTTGG + Intergenic
999581352 5:153041829-153041851 TGGTTCCAAGTCTTTGTTTTTGG + Intergenic
1000750515 5:165089998-165090020 AGGTACCAAATTCTTCTGTTAGG + Intergenic
1006361095 6:33587731-33587753 AGGTGGCAAGTCTTTCTGATAGG - Intergenic
1007949062 6:45853421-45853443 GGTTTCCAACTCTTGCTGTAGGG + Intergenic
1008453440 6:51680151-51680173 ATTTTCCAAATCTCTCTGTTTGG - Intronic
1008889924 6:56476254-56476276 AGCTTCCAACAATTCCTGTTTGG + Exonic
1014607355 6:123493683-123493705 CGCTTCCATCTGTTTCTGTTTGG - Intronic
1016702809 6:147072446-147072468 AGCTTCCAGCTCTTTGTGTCAGG - Intergenic
1018797411 6:167197493-167197515 AGTTTCCCACTATTTTTGTTTGG + Intergenic
1021148878 7:17124747-17124769 AGTTTCCATCTCGTTCTCTTTGG + Intergenic
1023485034 7:40677173-40677195 AGGTTCCAACTCTTTCTGTTTGG - Intronic
1024120860 7:46237937-46237959 TGGTTTCACCTCTTTGTGTTTGG - Intergenic
1024773005 7:52746959-52746981 ATGTTCCAATTCTTTCTGTCAGG - Intergenic
1027593147 7:80139433-80139455 ATGTGCCAACAGTTTCTGTTTGG - Intronic
1027732801 7:81897579-81897601 AGGTTCCATCTATTGCTTTTGGG + Intergenic
1033000461 7:137498828-137498850 ATGATCCAACTCTTGCTGTCAGG - Intronic
1033781331 7:144672900-144672922 AGGTTCCATCTGTTTCTGCTGGG - Intronic
1036428814 8:8670711-8670733 AAGTACCAACTCTTTCCGGTAGG + Intergenic
1039136233 8:34326229-34326251 AGGGAGCAACTCTTTCTCTTGGG - Intergenic
1042404020 8:68382802-68382824 GGATTCCAACACTTTCTATTTGG + Intronic
1046796593 8:118380269-118380291 AGGTTCCATCTCTAGCTGTTGGG + Intronic
1047308582 8:123673511-123673533 TAGTTCCAGCTTTTTCTGTTGGG - Intergenic
1048919673 8:139216840-139216862 AGGTTCCAGGTATTTCTGATAGG + Intergenic
1050146937 9:2578572-2578594 AGGTTCCAGCTCTTACTGGAAGG - Intergenic
1050605160 9:7293357-7293379 AGGATCCAACACTCTATGTTTGG - Intergenic
1053100618 9:35369213-35369235 AAGTACCTACTTTTTCTGTTGGG + Intronic
1055637008 9:78288840-78288862 AGAATACAACTCTTTCTGTTAGG - Intergenic
1059210423 9:112509731-112509753 AGGTTGAAACATTTTCTGTTTGG + Intronic
1185930801 X:4201593-4201615 AGGTTCCAATTCTCTGTGTCTGG + Intergenic
1187823479 X:23312343-23312365 AGATTCCAACCATTTCTGTGTGG + Intergenic
1188617840 X:32180512-32180534 AGGTCCCAACTCATTCTGAAGGG - Intronic
1189683501 X:43540614-43540636 AGGTTCCAAGGATTTCTTTTTGG + Intergenic
1190417221 X:50191875-50191897 AGTTTCAAACTGTTTCTGGTAGG + Intronic
1191934059 X:66407368-66407390 TGGTACCAACTTTTTATGTTAGG + Intergenic
1193561251 X:83019322-83019344 TGTTTCCAACTCTTACTGTAGGG - Intergenic
1195773244 X:108374676-108374698 AGATTCTAACTCTTTTTCTTTGG - Intronic
1196408599 X:115393022-115393044 AGTTGCCAACTCTTCCTCTTTGG + Intergenic
1196710712 X:118759215-118759237 AGGTTCTAACTCCTTCACTTTGG + Intronic
1197292860 X:124681538-124681560 AGGATACAACACTTACTGTTTGG + Intronic
1198315261 X:135459662-135459684 AGGCTCCACCTCTTTTTTTTTGG - Intergenic
1199210217 X:145199553-145199575 ATGTGCAAACTCTTTCTCTTAGG + Intergenic
1200805344 Y:7428028-7428050 AGATTGCAGCTCTTCCTGTTCGG - Intergenic
1200850442 Y:7877628-7877650 ATGTTACAAAGCTTTCTGTTGGG + Intergenic