ID: 1023485038

View in Genome Browser
Species Human (GRCh38)
Location 7:40677209-40677231
Sequence GTTGGCCGAATGAAAGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023485038_1023485039 -10 Left 1023485038 7:40677209-40677231 CCTATCTCTTTCATTCGGCCAAC 0: 1
1: 0
2: 1
3: 8
4: 102
Right 1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG 0: 1
1: 0
2: 0
3: 7
4: 100
1023485038_1023485041 18 Left 1023485038 7:40677209-40677231 CCTATCTCTTTCATTCGGCCAAC 0: 1
1: 0
2: 1
3: 8
4: 102
Right 1023485041 7:40677250-40677272 TTCTCTAAAGCACCCCTTCTTGG 0: 1
1: 0
2: 0
3: 8
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023485038 Original CRISPR GTTGGCCGAATGAAAGAGAT AGG (reversed) Intronic
900772674 1:4558255-4558277 TTTGGCCGCATGCAAGAGACTGG - Intergenic
906269837 1:44467951-44467973 GGAGGCCCAAGGAAAGAGATGGG + Intronic
911283422 1:95959512-95959534 ATGGGCCGAATTAAAGGGATAGG - Intergenic
913576647 1:120182055-120182077 ATTGGAAGAATGAAAGAAATGGG - Intergenic
914558555 1:148793490-148793512 ATTGGAAGAATGAAAGAAATGGG - Intergenic
914614280 1:149336740-149336762 ATTGGAAGAATGAAAGAAATGGG + Intergenic
915408705 1:155683341-155683363 GGTGGTTTAATGAAAGAGATGGG + Intronic
917903821 1:179570416-179570438 GATGGCCGAATGAAAGGAATAGG + Intronic
918579601 1:186110643-186110665 ATTTGCTGAAAGAAAGAGATTGG + Intronic
1063468327 10:6263206-6263228 ATGGGCCGAATTAAAGAAATAGG + Intergenic
1071367504 10:84914234-84914256 ATTGGTTGAATGTAAGAGATGGG - Intergenic
1072095980 10:92180430-92180452 GTTGGAGGAATGAAGGAGGTAGG - Intronic
1073213293 10:101821880-101821902 ATTTGCGGAATGAATGAGATAGG + Intergenic
1073299052 10:102459709-102459731 GGTGTCCGAAAGAGAGAGATTGG + Intergenic
1075137892 10:119802282-119802304 GCTGGCAGAATAAAAAAGATGGG + Intronic
1078774334 11:14380820-14380842 GTTTGCCTAATTAAAGAGGTGGG + Intergenic
1079468213 11:20753559-20753581 GGTGGCCTAATGAAGGAGACCGG - Intronic
1081932706 11:46883476-46883498 GTGGGCCGAATTAAAGAAATAGG - Intronic
1082249859 11:49966010-49966032 GTGGGCCGAATTAAAGGAATAGG - Intergenic
1085750524 11:79157018-79157040 GTTTGCGGAATGAGTGAGATGGG + Intronic
1086522592 11:87687401-87687423 ATGGGCCGAAATAAAGAGATGGG - Intergenic
1087172105 11:95059739-95059761 GTTGTCTGAATGAGTGAGATAGG - Intergenic
1092598145 12:10030231-10030253 ATGGGCCGAATTAAAGAAATAGG - Intergenic
1095434732 12:42175228-42175250 TTATGCCGAGTGAAAGAGATTGG + Intronic
1098090912 12:66900088-66900110 GTTGGGAGAAGTAAAGAGATTGG + Intergenic
1098329665 12:69339926-69339948 GTTAGCCAAATGAGAGAGGTAGG - Intergenic
1099671179 12:85695087-85695109 TTTGGCTGTATGAAAGTGATAGG - Intergenic
1100080560 12:90844252-90844274 GTTGGCCAAATGGAAGAAATAGG + Intergenic
1103830380 12:123774617-123774639 ATGGGCCGAATTAAAGAAATAGG + Intronic
1106557439 13:30822260-30822282 GTTGGTCGAATGGAATAGAATGG - Intergenic
1107072075 13:36281315-36281337 TTTGGCAGAATGTAAGAGAAAGG - Intronic
1114956300 14:27823797-27823819 GTTTTCCCAAAGAAAGAGATGGG - Intergenic
1120629049 14:86866141-86866163 GGTGGCAGAATGAAAGAGTATGG + Intergenic
1121584856 14:95056339-95056361 GCTGGCCGATTGCTAGAGATGGG - Intergenic
1124915451 15:33966628-33966650 ATTGGCTGGATGAAAGAGAATGG - Intronic
1134571116 16:15291971-15291993 GTTGCCCTAATGATAGGGATGGG - Intergenic
1134731264 16:16464105-16464127 GTTGCCCTAATGATAGGGATGGG + Intergenic
1134936164 16:18247762-18247784 GTTGCCCTAATGATAGGGATGGG - Intergenic
1137368265 16:47879749-47879771 GTTGGCTGAAGAAAAGTGATAGG + Intergenic
1138995119 16:62441680-62441702 ATTGACAGAATGAAAGAGAAAGG + Intergenic
1139897262 16:70297546-70297568 ATTGGCAAAATGAAAGAGGTTGG + Intronic
1141018729 16:80474925-80474947 GTGGGCTCAATGTAAGAGATGGG - Intergenic
1141854920 16:86674244-86674266 GTTGGAGGGATGAAAGGGATGGG - Intergenic
1149013857 17:51885823-51885845 GTTGACCAAATGAAAGAAGTAGG + Intronic
1153005673 18:497154-497176 GTTTGCTGAATGCAACAGATAGG + Intronic
1155765117 18:29620175-29620197 GTTGGCCAAATTAAAGAAAGGGG + Intergenic
1157183220 18:45516274-45516296 TTTGGCTGAAAGAAAGAGAAAGG - Intronic
1159937575 18:74381451-74381473 ATGGGCCGAATTAAAGAAATAGG + Intergenic
1163398693 19:17078795-17078817 GTTGGCAGAATGAGAGAGCTGGG - Intronic
1164561181 19:29293293-29293315 GTTGGATGGAAGAAAGAGATCGG - Intergenic
1166722030 19:45002150-45002172 GTTGGCCGAAAGAAGGGGAAGGG + Intronic
1167676145 19:50887332-50887354 GATGGCCGAGAGAGAGAGATGGG + Intergenic
927390108 2:22585141-22585163 TTTTGCTGAATGAAAGAGACAGG + Intergenic
933083139 2:78019378-78019400 GTTTGGCGAATGAAAGGGGTAGG - Intergenic
935925766 2:108066795-108066817 GTTGGCAGAGTAAATGAGATAGG - Intergenic
936653780 2:114460775-114460797 TTTGTCCTAATGAAAGAAATAGG - Intronic
938899663 2:135789444-135789466 GTTGAATGAATGAAGGAGATGGG + Intronic
941414046 2:165196415-165196437 GTTGGCAGAATGTTAGAGATGGG + Intronic
942722366 2:178966750-178966772 GTTTGACGAATGAAAGAAGTAGG + Intronic
943815656 2:192250805-192250827 GAGGGCCCAATGAAAGAGACTGG - Intergenic
947697025 2:232199781-232199803 GCTGGGGGAATGATAGAGATGGG + Intronic
947952763 2:234162200-234162222 ATTGGCTGAATGACTGAGATGGG + Intergenic
1169183703 20:3593880-3593902 GTTGGCCAGATGAGGGAGATGGG + Intronic
1170021003 20:11836755-11836777 GCAGGCAGAATCAAAGAGATAGG - Intergenic
1170099722 20:12685699-12685721 GTTGACAGAATTAAAAAGATAGG - Intergenic
1174766358 20:53257588-53257610 AATGGGCAAATGAAAGAGATTGG - Intronic
1177419592 21:20838998-20839020 GTGGGCCGAATTAAAGGCATAGG - Intergenic
951639679 3:24822788-24822810 ATTGGCAGATTGTAAGAGATAGG - Intergenic
951646750 3:24900314-24900336 GTTTGTGGAATGAAAGAGAGAGG + Intergenic
956223566 3:66930723-66930745 ATTTGCAGAATGAAAGAAATAGG - Intergenic
965047689 3:163599541-163599563 GTTGGCCTAATAAGAGAGTTAGG + Intergenic
966978226 3:185105461-185105483 ATGGGCCGAATGAAAGGAATAGG - Intronic
966978824 3:185110796-185110818 ATGGGCCGAATGAAAGGAATAGG - Intronic
967395187 3:189000632-189000654 GATGGCCAAATGAAACAGAGAGG - Intronic
970555788 4:17231251-17231273 ATTGGCAGTATGAAAGAGAGTGG + Intergenic
974581182 4:63804031-63804053 GTGGGCCGAAATAAAGGGATGGG + Intergenic
976820038 4:89195710-89195732 GTGGGCCAGATGATAGAGATTGG + Intergenic
980889115 4:138795177-138795199 TTTGGCTGAATGAAACAGGTGGG - Intergenic
981805019 4:148705108-148705130 GTTGGCTGATTGAAAAAAATGGG + Intergenic
983702399 4:170614326-170614348 GTATGCCAAATGAAAGAAATAGG + Intergenic
983871500 4:172829319-172829341 GTTGGATGAAGGAAAGAGTTTGG + Intronic
989538409 5:42590478-42590500 GTTGGCAGCATGAGAGAGATGGG + Intronic
992629338 5:78665782-78665804 GTTTGGCGAATTAAAGAGAGAGG + Intronic
996990155 5:129620151-129620173 GATGGTCTAATGAAAGACATAGG + Intronic
999649037 5:153747489-153747511 CCTGGCCCAAAGAAAGAGATGGG + Intronic
1015067591 6:129050230-129050252 GTTTGCTGAATGACAGAGAGGGG - Intronic
1015347642 6:132178715-132178737 ATGGGCCGAATTAAAGAAATAGG - Intergenic
1019055372 6:169219355-169219377 GTTGGGTGAATGGATGAGATGGG + Intronic
1020957608 7:14761485-14761507 GTTGGCACAATAAAAAAGATAGG - Intronic
1023485038 7:40677209-40677231 GTTGGCCGAATGAAAGAGATAGG - Intronic
1028082158 7:86590926-86590948 GTTGCCCATATGATAGAGATTGG - Intergenic
1031443531 7:121823081-121823103 GATGGTAGAATAAAAGAGATTGG - Intergenic
1031672532 7:124567443-124567465 GTTGGTAGAATATAAGAGATAGG + Intergenic
1032436631 7:131906306-131906328 GGTTGCCAAATGGAAGAGATGGG + Intergenic
1037613141 8:20493465-20493487 GTGGGCAGAATCAAAGACATTGG + Intergenic
1037667388 8:20981835-20981857 TGTCGCCAAATGAAAGAGATAGG - Intergenic
1039036788 8:33368335-33368357 GTAGGCCCAATTAAGGAGATCGG - Intergenic
1043055800 8:75436535-75436557 GTTGCCCGAACAAAAGATATTGG + Intronic
1044740506 8:95321612-95321634 GTTGGCAGAATTAAAGAGATGGG + Intergenic
1045709949 8:104971494-104971516 TTTGACCGACTGAAAGAGATTGG - Intronic
1047760023 8:127947588-127947610 TTTGGCAGAATGAAAGAGTCAGG + Intergenic
1047900954 8:129422164-129422186 GTTGGGGGAATGAATGACATAGG - Intergenic
1055659639 9:78490183-78490205 TTTGTCCAAATTAAAGAGATGGG - Intergenic
1059224901 9:112662964-112662986 CTTGGCCTAATGCAAGAGAAAGG + Exonic
1059636272 9:116173999-116174021 GTTGGCCAAGTGACAAAGATGGG - Intronic
1186061765 X:5716034-5716056 GTTTGCCTAAGGAAAGGGATTGG + Intergenic
1187535294 X:20136182-20136204 GTTGTAGGAATGAATGAGATTGG - Intronic
1193889234 X:87022837-87022859 GTTGGCCAAATGAATGAGTTTGG - Intergenic
1194355233 X:92874866-92874888 ATGGGCCGAAATAAAGAGATGGG + Intergenic
1199008296 X:142728995-142729017 ATGGGCCGAATTAAAGAAATAGG + Intergenic
1201357911 Y:13115685-13115707 GGTGGATGAATGAAAGAGAATGG + Intergenic
1201433854 Y:13934643-13934665 GTTGGGGGAATGAAAAAGAGTGG - Intergenic