ID: 1023485039

View in Genome Browser
Species Human (GRCh38)
Location 7:40677222-40677244
Sequence TTCGGCCAACTCTACATTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 100}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023485036_1023485039 -2 Left 1023485036 7:40677201-40677223 CCAGATGTCCTATCTCTTTCATT 0: 1
1: 0
2: 2
3: 18
4: 289
Right 1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG 0: 1
1: 0
2: 0
3: 7
4: 100
1023485038_1023485039 -10 Left 1023485038 7:40677209-40677231 CCTATCTCTTTCATTCGGCCAAC 0: 1
1: 0
2: 1
3: 8
4: 102
Right 1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG 0: 1
1: 0
2: 0
3: 7
4: 100
1023485035_1023485039 6 Left 1023485035 7:40677193-40677215 CCTCACAGCCAGATGTCCTATCT 0: 1
1: 0
2: 0
3: 14
4: 175
Right 1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG 0: 1
1: 0
2: 0
3: 7
4: 100
1023485034_1023485039 26 Left 1023485034 7:40677173-40677195 CCAAACAGAAAGAGTTGGAACCT 0: 1
1: 0
2: 0
3: 16
4: 131
Right 1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG 0: 1
1: 0
2: 0
3: 7
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023485039 Original CRISPR TTCGGCCAACTCTACATTTT AGG Intronic
900334457 1:2154747-2154769 TTCGTCCAGCTCTACTTTCTGGG + Intronic
904546475 1:31277635-31277657 TTCTGCCAATGCTTCATTTTCGG - Intronic
910008747 1:82433899-82433921 TTGTGACAACTCTCCATTTTAGG - Intergenic
910418519 1:87028678-87028700 TTTTGCAAACTCTAAATTTTGGG + Intronic
910614568 1:89182973-89182995 TTTGCTCAACTCAACATTTTAGG - Exonic
914713438 1:150235287-150235309 TGCGGCCAACTCATCTTTTTAGG - Intronic
917708707 1:177661129-177661151 TTATTTCAACTCTACATTTTTGG - Intergenic
1064379134 10:14824722-14824744 TTCTGCCAGCTTTAAATTTTGGG - Intronic
1070582173 10:77730362-77730384 TTAGACCAACTCTGCATTCTGGG - Intergenic
1070956474 10:80466973-80466995 TTCTGCTGACTCTAAATTTTTGG - Intronic
1085935273 11:81134089-81134111 TTCTGCAAGCTGTACATTTTGGG - Intergenic
1091085073 11:132713646-132713668 TTGGGCCAACTCCAGATTTCTGG - Intronic
1093160473 12:15740985-15741007 TTAGGACAACTCTCCATTATTGG - Intronic
1100911881 12:99373484-99373506 TTGGACCAAATCTACATTCTTGG - Intronic
1104949195 12:132431408-132431430 TTCGGCCATGTGTGCATTTTTGG - Intergenic
1105573023 13:21622201-21622223 CTCAGTCAACTCTTCATTTTTGG - Intergenic
1106441167 13:29772764-29772786 TTCTTCCAAGTCTTCATTTTGGG - Intronic
1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG + Intronic
1112247747 13:97749933-97749955 CCCAGCCAACTCTAAATTTTAGG - Intergenic
1114764838 14:25359166-25359188 TTCAGCTAACTCCAGATTTTAGG - Intergenic
1116606738 14:47008313-47008335 TTCTGCCAACACTACCTGTTAGG - Intronic
1118927171 14:70202666-70202688 TGTGGCCAAGTCTATATTTTTGG + Intergenic
1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG + Intronic
1126228376 15:46296991-46297013 TTTTGCCAATTCTGCATTTTTGG + Intergenic
1128861435 15:71077472-71077494 TTAGGCCAACTTTACATTCCTGG - Intergenic
1129897237 15:79117556-79117578 TTGGCCCAACTCTGCCTTTTGGG - Intergenic
1137038255 16:35585952-35585974 TTCAGCAAACTCTACAGATTTGG - Intergenic
1138069073 16:53972711-53972733 TTCAATCAGCTCTACATTTTAGG + Intronic
1144391430 17:14797179-14797201 TTCTGCCAACTCTGCTTTTACGG + Intergenic
1153109894 18:1573673-1573695 TTCTGCCAAATCTTGATTTTTGG + Intergenic
1153907740 18:9678042-9678064 CCTGGCCAACTCTAAATTTTAGG + Intergenic
1154489430 18:14908392-14908414 ATCAGCCAACTCAACATATTTGG + Intergenic
1155356237 18:24956808-24956830 TTTGGCCCACTCTAAATTTAGGG + Intergenic
1155834523 18:30563262-30563284 TTAATCCAACTCTACATTCTTGG + Intergenic
1156892046 18:42202436-42202458 TTAGGCCATGTCTACATTGTTGG - Intergenic
1160148153 18:76380668-76380690 TTCGAGGAACTCTACATTTAGGG + Intronic
1163948370 19:20561627-20561649 TTCAGCAAACTCTACAGATTTGG - Intronic
1163969734 19:20780657-20780679 TTCAGCTAACTCTACAGATTTGG + Intronic
1164006626 19:21155791-21155813 TTCAGCAAACTCTACAGATTTGG + Intronic
1164017729 19:21267504-21267526 TTCAGCAAACTCTACAGATTTGG - Intronic
1164070017 19:21758972-21758994 TTCAGCAAACTCTGCAGTTTTGG - Intronic
1164101507 19:22058585-22058607 TTCAGCAAACTCTACAGATTTGG + Intronic
1164136139 19:22418042-22418064 TTCAGCAAACTCTACAGATTTGG - Intronic
928076511 2:28269921-28269943 CTTGGCCAACTATACATATTAGG + Intronic
930949620 2:57124105-57124127 TTCTGACAAGTCTACATTATTGG + Intergenic
932879849 2:75491186-75491208 TTCAACCAATTCCACATTTTAGG - Intronic
933226975 2:79761204-79761226 TTCGGCCACGTCTATGTTTTAGG + Intronic
940239057 2:151543518-151543540 TTAGTCCAACTCTTCAGTTTAGG + Intronic
941130634 2:161645713-161645735 TTCAGCCAACACTAAATTTTTGG - Intronic
941572042 2:167182582-167182604 TTCTGCTGACTCTACATGTTTGG - Intronic
942926537 2:181439794-181439816 TTCTTACAACTCTACACTTTCGG + Intergenic
944032360 2:195250858-195250880 TTCATCCAATTCCACATTTTAGG - Intergenic
944219480 2:197288084-197288106 TTGGGCAAACCCTAAATTTTTGG - Intronic
945734604 2:213584121-213584143 TTTGGCCAATACTACATGTTAGG - Intronic
945781410 2:214177557-214177579 TTCTCCCAACTCTATTTTTTAGG + Intronic
1174488953 20:50878757-50878779 TTGTGCCAACACTACATTTTGGG - Intronic
1176948073 21:15008369-15008391 TTCGCCCAACTCTAGAGGTTTGG - Intronic
1180117236 21:45717652-45717674 TTAAGCCAACTTTGCATTTTGGG + Intronic
1180367889 22:11957192-11957214 CTCGGCCCCCTCTACACTTTGGG + Intergenic
949099706 3:129243-129265 TTGCCCCAACTCTATATTTTTGG + Intergenic
951344477 3:21530365-21530387 TTGAGCAAAGTCTACATTTTAGG + Intronic
958057674 3:88434099-88434121 TGCCCCCAAGTCTACATTTTAGG - Intergenic
961367835 3:126412624-126412646 TTCAACCAACTCTGCATTTTTGG + Intronic
964461369 3:156933730-156933752 TTAAGCCAACTATCCATTTTAGG + Intronic
979228725 4:118321744-118321766 TTCCCCCAACTTTACTTTTTGGG - Intronic
980164560 4:129209664-129209686 TTCCTCCAACTCTAGATGTTTGG - Intergenic
980341952 4:131561958-131561980 TTTGGCCAAATGTGCATTTTGGG - Intergenic
981761212 4:148197063-148197085 TTCTTCCAACTCTACCTTTTTGG - Intronic
983927217 4:173415100-173415122 TTCTGCCAACTCTCCAATTTGGG - Intergenic
985348315 4:189031169-189031191 TTACGCCAACTCTATTTTTTTGG - Intergenic
986930304 5:12810407-12810429 CTCAGCCAGCACTACATTTTAGG + Intergenic
987259836 5:16192365-16192387 TTCAGATACCTCTACATTTTGGG - Intergenic
993352095 5:86862646-86862668 TTCTGCCAACTTTTCTTTTTGGG + Intergenic
994141262 5:96344110-96344132 TTATGTCAAATCTACATTTTGGG + Intergenic
994374005 5:98997586-98997608 CCCGGCCAAGTCTCCATTTTTGG - Intergenic
997046563 5:130326108-130326130 TTCTGTCAAATCTACATTTTAGG - Intergenic
1003929465 6:10909686-10909708 TACGGCCAACTTTCCTTTTTGGG - Intronic
1004623591 6:17353287-17353309 TTTGGACAACTTTACATATTAGG + Intergenic
1005134441 6:22551711-22551733 TTCAGACAGCTCTACATTTCAGG - Intergenic
1005209116 6:23440598-23440620 TCCACCCAACTCCACATTTTAGG + Intergenic
1006518086 6:34555706-34555728 CTGGGCCAACTCTACATGCTGGG - Intronic
1008117118 6:47564641-47564663 TTTCCCCAACTCTAAATTTTAGG + Intronic
1009724300 6:67517033-67517055 TTAGGCCAACTTTTCATTTCTGG - Intergenic
1010347354 6:74827040-74827062 GTAGTCCAACTCTTCATTTTGGG + Intergenic
1012936894 6:105377816-105377838 TTAGGCCAACTTTACAGATTGGG + Intronic
1015502622 6:133950204-133950226 CTAGGCCAGTTCTACATTTTAGG + Intergenic
1020497203 7:8870768-8870790 TTTTGCCAATTCTACCTTTTGGG - Intergenic
1021056176 7:16049086-16049108 TTCAGCCAACAAAACATTTTAGG + Intergenic
1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG + Intronic
1026632417 7:72048884-72048906 TGCAGCCACCTCAACATTTTCGG + Intronic
1028024378 7:85819300-85819322 TTCAGTCAACTCTTCATTCTTGG - Intergenic
1028273173 7:88818289-88818311 TTATGCCAACTCGAGATTTTTGG - Intronic
1029906009 7:104094014-104094036 TTCAGCCAAGTCTCCAATTTAGG - Intergenic
1030884916 7:114924563-114924585 TTCAGGCCACTCTAGATTTTCGG - Intronic
1031482447 7:122295373-122295395 TTCAGCAAAATCTACATTTTGGG - Intergenic
1032866390 7:135929546-135929568 AAAGGCCAACTCTACATATTTGG - Exonic
1033521586 7:142166365-142166387 TTTTGCCAACTCTACATGATAGG + Intronic
1040567340 8:48579551-48579573 TAGGGCCAACTTTAGATTTTAGG - Intergenic
1042307281 8:67344367-67344389 ATCGGTCAACTCTAGATTTCAGG + Intergenic
1042639842 8:70921763-70921785 TTCTGCTAATTATACATTTTAGG + Intergenic
1052787162 9:32839470-32839492 TTAAGACAACTCTACAGTTTGGG - Intergenic
1052796175 9:32925553-32925575 TTCGGCCAAGACTACATGCTTGG + Intergenic
1058637807 9:107053608-107053630 CTCAGCCAGTTCTACATTTTAGG + Intergenic
1188935211 X:36167368-36167390 TTCAGCAAACCCTCCATTTTAGG + Intergenic
1189768349 X:44395195-44395217 TTCAGCCCACTACACATTTTTGG - Intergenic
1191193393 X:57691449-57691471 TTCTTCCAACTTTACTTTTTTGG + Intergenic
1192727777 X:73769933-73769955 GTTGGCCAGCTCTACATCTTCGG - Intergenic
1193298077 X:79855169-79855191 TTCGGCCTACTTTATATTCTAGG - Intergenic