ID: 1023485618

View in Genome Browser
Species Human (GRCh38)
Location 7:40683207-40683229
Sequence TTCTAGTTAAGAAAGTGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023485617_1023485618 -7 Left 1023485617 7:40683191-40683213 CCAAGAGGCTTTGATGTTCTAGT 0: 1
1: 0
2: 0
3: 2
4: 136
Right 1023485618 7:40683207-40683229 TTCTAGTTAAGAAAGTGATCAGG 0: 1
1: 0
2: 0
3: 12
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023485618 Original CRISPR TTCTAGTTAAGAAAGTGATC AGG Intronic
905600665 1:39247692-39247714 TTAGACTTAAGAAAGTGATGGGG + Intronic
905763016 1:40576301-40576323 TTCCATTTAAGAAAGTGAAAGGG + Intergenic
905978911 1:42204807-42204829 TTCTAGTTCAGAAAGGAAACTGG - Intronic
906072019 1:43023977-43023999 TTTTGGTTAAGAAGGTGATTTGG + Intergenic
906573008 1:46861018-46861040 TTCTAGTTAAAAGAGTAAACTGG + Intergenic
906894381 1:49755263-49755285 TCCTAATTAAGAATATGATCTGG + Intronic
907091888 1:51732778-51732800 TTATAGTTAAGAATGTGTTTTGG + Intronic
908059209 1:60328721-60328743 GTTTACTTAAGAAAATGATCAGG + Intergenic
911787277 1:101966765-101966787 TTCTAGTTAATACACTGATATGG + Intronic
912979912 1:114362054-114362076 CTCTAGTTAAGTAACTGAACTGG + Intergenic
917203222 1:172540286-172540308 TTCTAGTTAATAATTTTATCTGG + Intronic
917685712 1:177413849-177413871 TTCTAGTTAAGAAAATAAACTGG + Intergenic
918192869 1:182192757-182192779 TTCTAGTAAAGAAAATGTGCAGG - Intergenic
922014366 1:221630054-221630076 TTATAGTTAAAAAAGAAATCAGG + Intergenic
924443315 1:244104615-244104637 TAATAGTTAAGAAAGTGAAAGGG - Intergenic
1064585515 10:16836091-16836113 TTCTAGTTAAGAGAGGGATGTGG + Intronic
1065003895 10:21362117-21362139 TTCTCTTTAAGAAAATGATGTGG + Intergenic
1068777375 10:60882787-60882809 TCCTAGTTCAGAAAGGGAACTGG + Intronic
1069975828 10:72212132-72212154 TTTTAGTTGAGATAGTGATTTGG - Intronic
1070378508 10:75857965-75857987 TTCTAATTAAAAATGTGAACAGG - Intronic
1070984335 10:80674970-80674992 TTATAGTTAATAATGTGTTCAGG - Intergenic
1072765941 10:98095344-98095366 TTCTAGGTAGGAAAGTAATGAGG + Intergenic
1073573689 10:104602613-104602635 TTTTAGTCTAGAAAGTGATATGG - Intergenic
1077810955 11:5636406-5636428 TTGTAGTGATGAAAATGATCTGG + Intronic
1078347173 11:10560929-10560951 TTCTAAGGAAGAAAGTGATATGG - Intronic
1085248834 11:75127875-75127897 TTCTGGCTAAGAGAGTGTTCTGG + Intronic
1085583897 11:77682348-77682370 TTCAAGTTAAAAAACTGATTTGG + Intronic
1086871400 11:92041807-92041829 TTTTTGTTAAGAAACTGATATGG + Intergenic
1088110229 11:106252013-106252035 TCCTATTTAAGAATGTGTTCTGG - Intergenic
1088335322 11:108697499-108697521 TTTTAGCTAAAAAAGTGATTTGG + Intronic
1088638474 11:111847855-111847877 TTTTGGTTTGGAAAGTGATCAGG - Intronic
1088782002 11:113144409-113144431 TTCTCGTTAATAAAGTGTTAGGG - Intronic
1091780184 12:3208626-3208648 TTCTGGTTGGGAAAGTGACCCGG - Intronic
1091859292 12:3765092-3765114 TTCTATTTAAGAAAGGGTTCTGG + Intergenic
1092705411 12:11278791-11278813 ATCTAATTCAGAAGGTGATCTGG + Intergenic
1092919301 12:13216360-13216382 TTCTAGTTAAGGAAATGTTGAGG + Exonic
1094277937 12:28699932-28699954 TTCTAGTTATCACAGTGACCAGG + Intergenic
1094472824 12:30819172-30819194 TTCTAGTTATGATGGTGATGGGG - Intergenic
1097847496 12:64381713-64381735 GTCTAGTTAAGAAACTGGACAGG + Intronic
1098360173 12:69646752-69646774 CTTTAGTTATGAAAGTAATCGGG + Intronic
1099079721 12:78161688-78161710 TTTCAGTTAAAAAAGTGATAAGG - Intronic
1099855455 12:88159114-88159136 TTCTAGTTTAAAAAAAGATCTGG - Intronic
1106853855 13:33825946-33825968 TTTGAGTTATGAAAGTGAACAGG + Intronic
1107923650 13:45236361-45236383 TTCTATTTATGAAAATAATCTGG + Intronic
1108019726 13:46114803-46114825 TCTTAGTTAAGAAAGAGATGAGG + Intergenic
1110097705 13:71550718-71550740 ATCTACTTAAGAAAGAGCTCTGG + Intronic
1113248745 13:108428235-108428257 TTGTAGATAAGAAATTGAACTGG + Intergenic
1113400056 13:109983397-109983419 TTCTAGTTAATAAAGCGTTCTGG - Intergenic
1114680225 14:24478128-24478150 CTCAAGTTAGGGAAGTGATCTGG + Intergenic
1115642848 14:35346064-35346086 ATATGGTTAAGAAAGTGATTAGG - Intergenic
1117592505 14:57286499-57286521 TTCTTGTTTATAAAGTGGTCTGG + Intronic
1117764189 14:59063278-59063300 TTCCTGTGAAGAATGTGATCAGG - Intergenic
1117855878 14:60032812-60032834 TTCTTGGGAAGAAAGTGTTCTGG - Intronic
1117912899 14:60651461-60651483 TTCCAGTTTAGAAAGTCATTGGG - Intronic
1118733235 14:68684013-68684035 TTCTCCTTAAGAAAGAGAGCAGG + Intronic
1120253243 14:82086293-82086315 TTAGAGATAAGAAAGTGATCTGG + Intergenic
1120279222 14:82418431-82418453 TTCTAGTCAAGCAAGTGCTAAGG - Intergenic
1122064486 14:99162611-99162633 TTCTCCTTAAGAAAGGGAACAGG + Intergenic
1124159800 15:27257963-27257985 TTTTAGTTAATAAAGTTATAAGG + Intronic
1125221854 15:37346996-37347018 TTCTATTTTAGAAAGTTATCAGG - Intergenic
1126204077 15:46022485-46022507 ATCTACTTAAAAAAGTGATTTGG + Intergenic
1129616244 15:77100658-77100680 TTTCAGCTAATAAAGTGATCAGG - Exonic
1130225305 15:82052806-82052828 TTCTATTTGAGAAAGTCAGCAGG - Intergenic
1133053675 16:3134237-3134259 TTCCATTTATGAAAGAGATCTGG + Intronic
1148132079 17:45268045-45268067 TTCTTGTTAACAAAGTCCTCTGG - Intronic
1148411804 17:47473563-47473585 TTCTCTTTAAGAGATTGATCAGG - Intergenic
1148521717 17:48283007-48283029 TTCTAGTTAAGAAGATGTTTGGG + Intronic
1149018059 17:51931874-51931896 CTCTATTTAAGAAAGTTTTCAGG + Intronic
1151248658 17:72816427-72816449 TTCTAATTAAGAAAGGGAATTGG - Intronic
1153368946 18:4292027-4292049 TTCTAGTTAAAATAGTTATTGGG - Intronic
1154405692 18:14088571-14088593 TTCTAGTTAAAAATGAGTTCTGG + Intronic
1156133685 18:34009076-34009098 TTCTAGCTGAGGTAGTGATCAGG + Intronic
1156394408 18:36685575-36685597 TTCTAGTGTGGAAAGTGATGAGG + Intronic
1162540013 19:11289492-11289514 TTTTAGTTAAGAATTTGAGCAGG + Intergenic
1166208240 19:41287441-41287463 TTCTAGTTCAGGATCTGATCTGG + Intronic
927298339 2:21481181-21481203 TTCTATTTAAGTAATTGAGCTGG + Intergenic
928905035 2:36358472-36358494 TTCTGGTGAAGGAAGTGCTCAGG + Intronic
929203652 2:39265431-39265453 CTCTAATTAAGAAACTGAACTGG - Intronic
929676493 2:43937036-43937058 TTCTAGTTTGGGAATTGATCTGG - Intronic
930368977 2:50480071-50480093 TTGTGTTTAAGAAAGGGATCAGG - Intronic
930455552 2:51604200-51604222 TTCCAGATAAGAAAATGCTCAGG - Intergenic
931040743 2:58296128-58296150 TTTTAGTTAGGAAAATTATCAGG + Intergenic
932333062 2:70910769-70910791 TTTTTTTTAAGAAAGTGACCTGG - Intronic
933589213 2:84213515-84213537 TTCTAGTTAAAAAATTGCTTTGG + Intergenic
935035144 2:99363477-99363499 TTCTAGTTACCAAAGTGCTCAGG + Intronic
935148719 2:100414487-100414509 TTGTAGTTCAGAATGTGCTCAGG - Intronic
936682426 2:114789422-114789444 TCATAATCAAGAAAGTGATCAGG + Intronic
939601491 2:144197648-144197670 TACTAGTTAAGAAATTTGTCTGG - Intronic
941312048 2:163945693-163945715 TTCTAGCTTAGAAAGTGTTCAGG + Intergenic
943119888 2:183722645-183722667 TTGGAGTGAAGAAAGTGCTCTGG + Intergenic
943190079 2:184664728-184664750 TTCTTGTTCAGAAAGTGTTTGGG + Intronic
943445050 2:187974325-187974347 TTCTTGTTAAGAAAGTATTTTGG + Intergenic
945328270 2:208508993-208509015 TTCTAAGCAAAAAAGTGATCAGG - Intronic
945848567 2:214978480-214978502 TTCATGTTAATGAAGTGATCTGG - Intronic
945900426 2:215531665-215531687 TTCAAGTAAAGAAAGAGATAAGG - Intergenic
947405930 2:229777360-229777382 TTCTAGGTGATAAACTGATCTGG + Exonic
948137614 2:235648571-235648593 TTCCAGTTAAGACAGTCATGTGG + Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1178078829 21:29040518-29040540 ATCAAGTCAAGAAAGTGATCAGG - Intronic
1178204992 21:30454830-30454852 TTCTCCTTTAGAAAGTGGTCTGG + Intergenic
1178548715 21:33516545-33516567 TTCTAGTTAAGCAGGTGAGTAGG - Intronic
1181161520 22:20962785-20962807 TTTTAGGTAAGAAAGTGGCCGGG - Intergenic
1182854259 22:33503096-33503118 TTCTAGTTCAGCAACTCATCTGG - Intronic
1184971990 22:48029506-48029528 TTGTAGTTAAGACTGTGATTAGG + Intergenic
949102831 3:166454-166476 TTCATGTTAAGAAAGTGAAAAGG + Intergenic
951201686 3:19882258-19882280 TTCTAGTTGAGAAAAGGAACAGG - Intronic
952781530 3:37104647-37104669 TTATATTTAAGAAATTGATTTGG - Intronic
954928276 3:54256818-54256840 TTCTGGATAAGAAAGTGCACTGG - Intronic
955232081 3:57108352-57108374 TTCTAGTTAAAAAAGACAGCTGG - Intronic
956923454 3:73955848-73955870 TTATAGTTAAGAAAGAAAACAGG - Intergenic
959513246 3:107237311-107237333 TTCTATTTTAAATAGTGATCAGG - Intergenic
960748588 3:120918876-120918898 TTCTAGTTCATAAAGAAATCAGG - Intronic
962431998 3:135328504-135328526 TTCTAGTTTAGAAAGACATTTGG - Intergenic
962955482 3:140262602-140262624 TTTTAGTAAAGAAAGTGAAGTGG + Intronic
964433825 3:156632014-156632036 TTTTAATTATGAAAGTGTTCAGG - Intergenic
967263457 3:187669050-187669072 TACTAGTTAAGAAAGCTAACAGG + Exonic
967848271 3:194061898-194061920 TTTTATTTAAGAACATGATCTGG - Intergenic
970134082 4:12903410-12903432 TTTTTTTTAAGAAATTGATCAGG + Intergenic
973860733 4:55062235-55062257 TTCTAGTTAAGAAGGGGATATGG + Intergenic
975991391 4:80263354-80263376 TTGTAGTTACGAAAGGGATAGGG + Intergenic
976094909 4:81498339-81498361 TTCTGGATAAGAATGTGCTCAGG - Intronic
977079334 4:92503796-92503818 TTCTACTTAATAAAGTGCCCAGG + Intronic
978483959 4:109228742-109228764 CTCTGGTCAAGAAAGGGATCTGG - Intronic
978630511 4:110738650-110738672 TTTTAGTTTAGAAATAGATCAGG - Intergenic
978816444 4:112911874-112911896 TTGTTGTTAAGAAACTGATGTGG + Intronic
979666860 4:123321106-123321128 TTCTATTAAGGAAAGTGTTCAGG - Intergenic
983034384 4:162844682-162844704 TTCTATATAAGACAGTCATCAGG + Intergenic
984266934 4:177506851-177506873 CTCTAGTTCAGAAAGTTACCAGG + Intergenic
987181838 5:15375835-15375857 TTGTAGGTATGAAACTGATCTGG + Intergenic
987196194 5:15528742-15528764 TTCCAGTTAGGAATGTGATATGG - Intronic
990083040 5:51940432-51940454 TTGTTGGTCAGAAAGTGATCTGG + Intergenic
990303714 5:54474459-54474481 ATCTTGTTAAGAAACTGAGCTGG - Intergenic
990652333 5:57915716-57915738 TTTTAGTTCAGAAAGTGGGCTGG - Intergenic
990727303 5:58770228-58770250 CTCTAGTTGAGAAAATGATGTGG - Intronic
992978696 5:82142983-82143005 TTCTATTCAAGAAAGAGGTCTGG + Intronic
993195908 5:84745171-84745193 TTCAGGTTAAAAAATTGATCAGG - Intergenic
993873172 5:93275265-93275287 TTATAGATAAGAAATTGATTTGG - Intergenic
995948130 5:117675380-117675402 TTCTAGAAGAGAAAGTGATATGG - Intergenic
996855898 5:128006107-128006129 TTTTAGTCAGGAAAGAGATCAGG - Intergenic
1000615338 5:163419724-163419746 TTCTTGTTAAGTAAGTGCTCAGG - Intergenic
1000982676 5:167833507-167833529 TTCTAGTGAAGAAAGTCACATGG + Intronic
1000984561 5:167852979-167853001 TTGTTCTTAAGAAAGTGATCGGG + Intronic
1003980166 6:11381892-11381914 TTCTACTTATGAAATTGTTCTGG - Intronic
1006990804 6:38213167-38213189 TTTTAGGTATGAAATTGATCAGG - Intronic
1008086118 6:47246105-47246127 TTCTCATTAAGATAGTGATATGG - Intronic
1011245339 6:85316174-85316196 TTCTAAATAAGAAAGTGAATGGG - Intergenic
1011629006 6:89306694-89306716 TTGTGGTGAAGAAAATGATCTGG - Intronic
1013529087 6:111002632-111002654 TTCTTGTTAAGAATGAGACCTGG - Intronic
1013774343 6:113662911-113662933 TTCTTGATAAGAAAGTGCTTAGG + Intergenic
1016786465 6:148015978-148016000 TTCTAGTCAAGAAAAGGAGCTGG - Intergenic
1020551313 7:9608737-9608759 TTCTGGGTAAGAATGTGTTCTGG + Intergenic
1020783294 7:12542427-12542449 ATATAGATAAGAAAGAGATCAGG - Intergenic
1021376968 7:19920526-19920548 CTCTAGTCAAGAAACTGAACAGG - Intergenic
1022638594 7:32160538-32160560 TTTTAGTGAAGAAAGGAATCTGG + Intronic
1022657097 7:32329572-32329594 TTCTAGTTCAGAAAGTTTGCGGG + Intergenic
1023485618 7:40683207-40683229 TTCTAGTTAAGAAAGTGATCAGG + Intronic
1025841533 7:65154061-65154083 TTCTAGTTCTAAAAGTGAACAGG - Intergenic
1025881516 7:65541905-65541927 TTCTAGTTCTAAAAGTGAACAGG + Intergenic
1025891923 7:65660710-65660732 TTCTAGTTCTAAAAGTGAACAGG - Intergenic
1027840396 7:83303648-83303670 TTCTATTACAGATAGTGATCAGG - Intergenic
1027919903 7:84379594-84379616 TTCAATTTGAGGAAGTGATCAGG + Intronic
1028123332 7:87082718-87082740 TTCTGGTTAAGTAAGTCATTGGG - Intergenic
1028214375 7:88113605-88113627 TTCTAGGGAAGAAAATAATCAGG - Intronic
1028453910 7:91017864-91017886 TTTTAGTTATGAAAATAATCTGG - Intronic
1031201584 7:118694944-118694966 TACTAGTTAAGGGACTGATCAGG + Intergenic
1037431968 8:18823115-18823137 TTCTAGTTATTGAAGTGATAAGG - Intronic
1038058601 8:23886699-23886721 TTCTAGTTTATACAGTCATCAGG - Intergenic
1038924138 8:32118966-32118988 TTCTTGTTAAGAATCTGGTCTGG + Intronic
1041468769 8:58185178-58185200 TTTTATTTAAGGAAATGATCAGG - Intronic
1043527002 8:81108166-81108188 TTCAAGTCACAAAAGTGATCAGG + Intronic
1045688486 8:104736230-104736252 TGGTAGTTAGGAAAGAGATCAGG + Intronic
1049075320 8:140391414-140391436 TAAGAGTTAAGAAAGTGAGCCGG + Intronic
1050133652 9:2439465-2439487 TTCTGGCTATGAAAGTGAGCGGG + Intergenic
1050270254 9:3936715-3936737 TTTTAGTACAGAGAGTGATCAGG - Intronic
1050713247 9:8489961-8489983 TTCTAGTTGGGAAAATAATCAGG + Intronic
1051944076 9:22544743-22544765 GTCTAGATCACAAAGTGATCAGG + Intergenic
1058567028 9:106296937-106296959 TTCAAGTTAAGAAACTGAGGAGG + Intergenic
1058786132 9:108389988-108390010 TTCAAGTTAAAAAGGTGTTCTGG + Intergenic
1061548323 9:131317722-131317744 TACTGGTTAGGAAGGTGATCAGG - Intergenic
1061568287 9:131459045-131459067 TTCTAATGAAGAAAATGATTTGG + Intronic
1187811163 X:23179100-23179122 TTCTACTTAGAGAAGTGATCTGG + Intergenic
1189401707 X:40675740-40675762 TTCTAGTTTAAAAAGTGAGATGG - Intronic
1192328230 X:70151525-70151547 TTCAAGATGAGAAAGTGCTCTGG + Intronic
1196646053 X:118117947-118117969 TTCTTCTTAAGGAAGTGATGCGG + Intergenic
1197357155 X:125449477-125449499 TTCTATTTAATAAATTGTTCTGG + Intergenic
1198744005 X:139871146-139871168 GTCTAGATAAGAAACTGAACAGG + Intronic
1202247196 Y:22832174-22832196 TTCTAGTAAAAAAAGAAATCAGG - Intergenic
1202400185 Y:24465922-24465944 TTCTAGTAAAAAAAGAAATCAGG - Intergenic
1202470596 Y:25204164-25204186 TTCTAGTAAAAAAAGAAATCAGG + Intergenic