ID: 1023488639

View in Genome Browser
Species Human (GRCh38)
Location 7:40713629-40713651
Sequence CTGTTGTGGTTAAGGCCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 87}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023488639 Original CRISPR CTGTTGTGGTTAAGGCCCAA AGG (reversed) Intronic
901372895 1:8815894-8815916 CTGTTGTTGTTGAGGTCGAAGGG - Intronic
902701732 1:18176844-18176866 CTGTTGTCCTTAAAGCCCCAGGG - Intronic
907285812 1:53378780-53378802 CTGCTGTGTTTAAGGGCCACTGG + Intergenic
909139112 1:71840945-71840967 GTGTTGTAGTTAAAGACCAAAGG - Intronic
914895430 1:151667436-151667458 CTTTTATTGTTAAGGCCAAAAGG - Intronic
918591803 1:186248925-186248947 CTGTTGTGGGAAGGACCCAATGG - Intergenic
919781178 1:201222213-201222235 TTGTGGTGGTTAAAGCCCAAAGG - Intronic
920775653 1:208934446-208934468 CTGTTGTAGAGAAGGCCCAAGGG + Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922171740 1:223161396-223161418 CTGTTGTGGTTTACGCACAGAGG + Intergenic
923273611 1:232378753-232378775 CTGTTGGGCTCCAGGCCCAAGGG + Intergenic
1064133354 10:12729832-12729854 CTGGTGTGGCCAAGGCCCAGCGG + Intronic
1065553417 10:26890968-26890990 TTGTTCTGGTTAAAGGCCAATGG + Intergenic
1070093416 10:73312191-73312213 CTGTCGGGGGTAAGGGCCAAGGG + Intronic
1070698683 10:78582814-78582836 CTGTTGAGGTCAAGGCCCTCAGG - Intergenic
1070918228 10:80168455-80168477 TTGTGTTGCTTAAGGCCCAAGGG - Intronic
1073733754 10:106322048-106322070 ATATTGTGGTTAAGGCCACACGG + Intergenic
1075625297 10:123959945-123959967 CTGCTGTATTCAAGGCCCAAAGG + Intergenic
1079725090 11:23870573-23870595 CTGTTGTTGGTAATGCCCAGTGG + Intergenic
1083397760 11:62402919-62402941 CTGTTGTGGGTTGGGCCCAGGGG - Intergenic
1094102394 12:26778180-26778202 CTGTGGTGGGAAAGGCCAAATGG + Intronic
1097065068 12:56315115-56315137 CTGTGGAGGTAAAGGCACAACGG - Exonic
1099147028 12:79059223-79059245 CTGTTGTGGGAGAGACCCAATGG - Intronic
1101052856 12:100881854-100881876 CTCTTGTGATACAGGCCCAAAGG + Intronic
1106719544 13:32424437-32424459 CTGCTGTGGGTAAGGGCCAGTGG - Intronic
1107052474 13:36066343-36066365 GTGTTGTGGCCAAGGACCAATGG - Intronic
1110820580 13:79910596-79910618 CTGTTGTTCTTAAAGCCCCAGGG - Intergenic
1116080218 14:40162322-40162344 GTTTTGTGGGTCAGGCCCAATGG + Intergenic
1117491109 14:56249005-56249027 CCTTTGTGGGAAAGGCCCAACGG - Intronic
1120511525 14:85421554-85421576 CTGACATGGTTAAGGCCCAAGGG - Intergenic
1120889305 14:89477524-89477546 CTGTTGTGGGTGAGGCCCCAAGG - Intronic
1122370225 14:101225483-101225505 CTGGTGTGGGTGGGGCCCAAAGG - Intergenic
1126362485 15:47860735-47860757 CTGTGCTCTTTAAGGCCCAAGGG - Intergenic
1138370593 16:56523564-56523586 CTGATGTGGTTGAGGGTCAAGGG - Intergenic
1139751976 16:69114460-69114482 CTGTTGCGGTACATGCCCAAGGG - Exonic
1142747839 17:1968806-1968828 GTGTTCTGGGTAAGCCCCAAAGG - Intronic
1149554565 17:57564076-57564098 CTGTTGTGCTCAAGACACAAAGG + Intronic
1157683027 18:49621892-49621914 CTGTTTGGGTTCAGCCCCAAGGG - Intergenic
1159559247 18:69976427-69976449 CTATGGTGGGAAAGGCCCAATGG - Intergenic
1163581032 19:18138862-18138884 CTGGTGTGTTTAAGGACCACGGG - Intronic
1166576533 19:43844802-43844824 TTGTAGTTGTTAAGGCTCAATGG + Intronic
925607632 2:5674589-5674611 CTGTTGAGGTTAAATCTCAAGGG - Intergenic
928214989 2:29353974-29353996 CTCTTGTGCTTAAGGACCAAAGG - Intronic
929560205 2:42951842-42951864 ATGTCTTGGTTAAGGCCCATGGG + Intergenic
937852701 2:126649803-126649825 CTGTTGTGGGAAAGGCCAAATGG - Intergenic
943317980 2:186412741-186412763 CTGTGGTGGGAAAGGCCAAATGG - Intergenic
948668683 2:239552470-239552492 CTGATGTGGCTAAGGACCCAGGG + Intergenic
1173130855 20:40391840-40391862 CTGTAGTGGTCATGGGCCAATGG + Intergenic
1174138100 20:48394313-48394335 CTTTTGTGGTTAAATACCAAAGG - Intergenic
1179417562 21:41210332-41210354 CTTTTATGGTTTAGGCACAACGG + Intronic
1181082222 22:20423340-20423362 CTGCTGGGGTTAAGGCCAAGAGG - Intergenic
1183984712 22:41563057-41563079 CTGCTGTGGTTAAGGCCTTTGGG - Intronic
951681139 3:25295856-25295878 CTGCTGTGGTAAAGGGCCTAAGG - Intronic
952123114 3:30267966-30267988 CTGTTGCCGTTACAGCCCAAAGG + Intergenic
953397586 3:42585242-42585264 CTGGTGTGGTTCAGGCACCATGG + Intronic
955218775 3:57006818-57006840 CTGTGGCGCTTAGGGCCCAAGGG - Intronic
971197795 4:24486075-24486097 CTGTTGTGGTAGAGGCCCTTGGG + Intergenic
971939552 4:33197833-33197855 CTGGTGTGGTTACAGCCCAAAGG + Intergenic
974564662 4:63567234-63567256 CTATTGTGGGAAAGGCCAAATGG + Intergenic
974581860 4:63814242-63814264 CTACTGTGGTTAAGGCCTACAGG - Intergenic
979626153 4:122847769-122847791 ATGTTGTGGTTCAAGACCAAAGG + Intronic
983418808 4:167492149-167492171 TTCTTGTTGTTATGGCCCAATGG - Intergenic
983861548 4:172713381-172713403 ATGTTGTGGTTCAAGTCCAAAGG + Intronic
984126729 4:175819544-175819566 CTGTTGTGGTGAAGGTTAAATGG - Intronic
984588384 4:181588574-181588596 CAGTTTTGGTTAAGGCTCTAGGG - Intergenic
988180169 5:27781320-27781342 CTGTTGTGGTGAATTCCCATAGG + Intergenic
989666763 5:43863533-43863555 CTTATGTGGATAAGGCCAAATGG + Intergenic
990488529 5:56281826-56281848 ATGTTGTGGGAAAGACCCAAGGG - Intergenic
993810348 5:92468338-92468360 CTGTTATGGATCAGGCACAAGGG - Intergenic
996081594 5:119263818-119263840 AAGATGTGGTTAAGGCACAAAGG + Intergenic
999544138 5:152608098-152608120 CTGTTTTTGATAATGCCCAAAGG + Intergenic
1001834277 5:174817882-174817904 CTGTTGCAGTTGAAGCCCAAAGG - Intergenic
1005551666 6:26924802-26924824 CTGTTGTTGTTAAGTCTCTATGG + Intergenic
1010263873 6:73845831-73845853 GTGTTGTGGGAAAGACCCAAGGG + Intergenic
1014246649 6:119077882-119077904 CTGTGCTGGTTTAGCCCCAAAGG + Intronic
1014727992 6:124996154-124996176 CTGTTGAGGTTATGGAGCAATGG - Intronic
1019616444 7:1965012-1965034 GTGTGGTGGTCAAGGCCCACTGG - Intronic
1022827743 7:34033696-34033718 CTTCTGTGGTCAATGCCCAAGGG - Intronic
1023488639 7:40713629-40713651 CTGTTGTGGTTAAGGCCCAAAGG - Intronic
1029150862 7:98479455-98479477 CTGTTTTTGTTAGGGTCCAAGGG + Intergenic
1035552830 8:543794-543816 CTGATGCTGTTAAGGCCGAATGG - Intronic
1037184245 8:16042399-16042421 ATGTTGAGGTTCAGGCCAAATGG + Intergenic
1037505943 8:19529365-19529387 CAGTAGTGGTCAAGGCCCACAGG - Intronic
1042137465 8:65645386-65645408 CTGCTGTTGTTAATGCCCAAAGG - Intronic
1042784217 8:72529390-72529412 CTGTTGTGGTTAATGCTAATTGG - Intergenic
1044743149 8:95347952-95347974 CAGTTGTGGTAAAGCCACAATGG - Intergenic
1046984159 8:120369283-120369305 CTGTTGTGGCAAAAGACCAACGG + Intronic
1056385802 9:86095926-86095948 CTGATGTGGGTCAGGCCAAAAGG + Intronic
1058758893 9:108110326-108110348 CTCATCTGGTTAAGACCCAATGG + Intergenic
1059124490 9:111671053-111671075 CTGTTGTTGTTAAGACAGAATGG - Intergenic
1187972820 X:24675483-24675505 CTTGTGTCATTAAGGCCCAATGG + Intergenic
1190601638 X:52098895-52098917 CTGTGGTGGGAAAGGCCAAATGG - Intergenic
1192044586 X:67658690-67658712 CTGTAGGGGTCAAGGCCAAAGGG + Intronic
1192172945 X:68868010-68868032 CGGGTGTTGTCAAGGCCCAAGGG - Intergenic
1194839660 X:98725415-98725437 CTGTGTTGGTCAAGGCCCTAGGG + Intergenic
1195422520 X:104691422-104691444 CTGTTTTGGTTAAACTCCAAGGG + Intronic