ID: 1023489335

View in Genome Browser
Species Human (GRCh38)
Location 7:40721237-40721259
Sequence GTGTAAATATCAATGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023489325_1023489335 12 Left 1023489325 7:40721202-40721224 CCCCTTGATTTTTCTTTTTTTTA 0: 1
1: 4
2: 89
3: 1410
4: 17986
Right 1023489335 7:40721237-40721259 GTGTAAATATCAATGCTGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 115
1023489327_1023489335 10 Left 1023489327 7:40721204-40721226 CCTTGATTTTTCTTTTTTTTAAA 0: 1
1: 14
2: 127
3: 1356
4: 8760
Right 1023489335 7:40721237-40721259 GTGTAAATATCAATGCTGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 115
1023489326_1023489335 11 Left 1023489326 7:40721203-40721225 CCCTTGATTTTTCTTTTTTTTAA 0: 1
1: 6
2: 154
3: 1738
4: 13254
Right 1023489335 7:40721237-40721259 GTGTAAATATCAATGCTGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 115
1023489324_1023489335 13 Left 1023489324 7:40721201-40721223 CCCCCTTGATTTTTCTTTTTTTT 0: 1
1: 11
2: 225
3: 3918
4: 28871
Right 1023489335 7:40721237-40721259 GTGTAAATATCAATGCTGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023489335 Original CRISPR GTGTAAATATCAATGCTGGG AGG Intronic
901318903 1:8327510-8327532 GTATAAAAATCAATACTGGTTGG + Intronic
903568157 1:24284535-24284557 GTTTAAATATCATTTCTGGCTGG + Intergenic
918843878 1:189583391-189583413 GTCTAGATATCAATTCTGGTAGG + Intergenic
919616616 1:199815991-199816013 TTGTAATTCCCAATGCTGGGGGG + Intergenic
923458047 1:234182708-234182730 ATGTAATTAGCAATGCTGTGGGG - Intronic
1063602176 10:7492219-7492241 ATGTAAATAAAAATGCTGAGTGG + Intergenic
1065253532 10:23841358-23841380 GAGTAACTGTCATTGCTGGGTGG + Intronic
1069323053 10:67197543-67197565 GTGTGAAAATGACTGCTGGGTGG + Intronic
1071988672 10:91077525-91077547 GTGTAAGCTTCAATCCTGGGGGG - Intergenic
1072588151 10:96800566-96800588 GTGTTAATGTTAATGCTGGTTGG - Intergenic
1072763363 10:98076699-98076721 GAGTGAATATCAGTGATGGGGGG + Intergenic
1072773035 10:98159102-98159124 TTGGAAATATCAATGTTGGCTGG - Intronic
1075752897 10:124788230-124788252 GAGTAAATATCCAAGTTGGGTGG - Intronic
1075977646 10:126709864-126709886 GTGTAAATATCAATGCCTGAAGG + Intergenic
1079395804 11:20062362-20062384 GAGTATAAATCAATGCTGTGTGG + Intronic
1085507484 11:77068544-77068566 GTGTGAAAATGAATGCTGGTGGG + Intronic
1086046913 11:82543530-82543552 GTATCAATATCACTACTGGGTGG - Intergenic
1088404218 11:109454826-109454848 GGCTAGATAACAATGCTGGGCGG - Intergenic
1091410744 12:237586-237608 GGGTGAATATCAGTACTGGGGGG + Intronic
1098049992 12:66443282-66443304 GATTAAATATCAAAGGTGGGGGG - Intronic
1101629614 12:106480325-106480347 TAGTGAATATCATTGCTGGGTGG + Intronic
1106756739 13:32829502-32829524 GTGTTGATGTTAATGCTGGGGGG + Intergenic
1106841892 13:33692736-33692758 GTGTTGATGTCAATGCTGGTCGG + Intergenic
1111594676 13:90396430-90396452 GGGTAAATACCAATGCTGTCAGG - Intergenic
1111808381 13:93066728-93066750 GCCTAAAGATCAATGCTGAGTGG + Intergenic
1113308155 13:109100866-109100888 GTGTAAATTACAAGGCTGGCAGG + Exonic
1114773974 14:25460591-25460613 GTGTAGATGTCAATGGTGGAGGG - Intergenic
1119561818 14:75596497-75596519 TTGTATATATCAATGATTGGTGG - Intronic
1120424891 14:84334720-84334742 GGGTAAATATGAATTTTGGGAGG + Intergenic
1121032627 14:90672138-90672160 GTGTAAGTGTTAATGCTGGTTGG + Intronic
1124873962 15:33573208-33573230 GAAAAAATATCAATGCTGAGGGG + Intronic
1127735338 15:61834129-61834151 CTCTAAATGTCAGTGCTGGGAGG - Intergenic
1128006398 15:64246145-64246167 GTGTAATTATCAAGTCAGGGTGG - Intronic
1129000161 15:72326376-72326398 GTGTATCTGTTAATGCTGGGTGG + Intronic
1131984728 15:98031110-98031132 ATGCAAATATCAATGCTATGGGG - Intergenic
1139072312 16:63397876-63397898 CAGTAAATATTAATGATGGGAGG - Intergenic
1140155387 16:72419722-72419744 GTTTAAAAATCAAAGCGGGGAGG - Intergenic
1140341518 16:74168947-74168969 GTGAAAATCTCAATGCTTAGGGG - Intergenic
1149767116 17:59288627-59288649 GTTTTAATATCAATGTTGGCCGG - Intergenic
1152353174 17:79794624-79794646 GAGAAAAGATGAATGCTGGGTGG - Exonic
1155090581 18:22505174-22505196 GTGTAAACCACATTGCTGGGTGG + Intergenic
1155260054 18:24032954-24032976 TTGAAAAGATCAATGCTGGCTGG + Intronic
1156960887 18:43028803-43028825 GTTGAAATATAAATGCTCGGGGG - Intronic
1157114471 18:44850296-44850318 GGGTGCATGTCAATGCTGGGTGG - Intronic
925385901 2:3461543-3461565 GTGTGAATGTCAGAGCTGGGAGG - Intronic
937505302 2:122529965-122529987 GTTCAAATATCAATGTGGGGGGG - Intergenic
943192859 2:184703404-184703426 ATGAAAATATCAATGCAGGCCGG + Intronic
945253667 2:207785895-207785917 GTTTAAATATGAAGCCTGGGAGG + Intergenic
946267497 2:218559568-218559590 GTTTAAATATAAATGGTAGGTGG - Intronic
947226913 2:227849403-227849425 GTGTCGATATTAATGCTGGTTGG - Intergenic
1170850864 20:20003365-20003387 GTAAAAATATACATGCTGGGTGG + Intergenic
1173699181 20:45052280-45052302 ATGTAATTATTATTGCTGGGGGG - Intronic
1174248877 20:49203126-49203148 GAGTACATATCAATGAGGGGTGG + Intergenic
1174296817 20:49551287-49551309 GTGTTGATATGAATGCTGGAGGG - Intronic
1179620116 21:42608735-42608757 GTGTTGATATCCATGCTGGCGGG + Intergenic
1183766430 22:39880293-39880315 GTGAAAAGATCAATGCTTGCAGG + Intronic
1184725160 22:46340297-46340319 GTTTCAAGATCAAGGCTGGGTGG + Intronic
951179657 3:19644439-19644461 TTATAATTACCAATGCTGGGGGG + Intergenic
951683618 3:25320946-25320968 GCTTAAATATCAATGTTGGGTGG - Intronic
952507576 3:34021331-34021353 GTGTGAATCTCATTGCTGCGGGG - Intergenic
953874961 3:46661369-46661391 TTGGAAATTTCACTGCTGGGTGG + Intergenic
955671274 3:61405767-61405789 GTGGGAATATCAATGTTTGGTGG - Intergenic
958727670 3:97925408-97925430 GTGTTAATTACAATGGTGGGGGG + Intronic
966401931 3:179556543-179556565 ATGTAAATAACAATAATGGGGGG + Intergenic
967769695 3:193321213-193321235 GTGATAATTTCAAGGCTGGGAGG - Intronic
970530993 4:16983226-16983248 TTGTAGATATCAATGCTTTGAGG - Intergenic
972272969 4:37530273-37530295 GTGAAAATAGCAATGCCGGCTGG + Intronic
972894596 4:43604186-43604208 ATGTACATTTCAATTCTGGGAGG - Intergenic
973651398 4:53000451-53000473 GTATAAACATGAATGGTGGGTGG - Intronic
976069928 4:81230076-81230098 GGGTATATCACAATGCTGGGGGG + Intergenic
979481849 4:121228480-121228502 CTGTAAATATCAATCCTGGTTGG + Intergenic
984098314 4:175458102-175458124 GTGTTAATGTTAATGCTGGAGGG + Intergenic
989002104 5:36772095-36772117 TTGTAAATAACAAGGCTTGGAGG + Intergenic
989968539 5:50493899-50493921 GTGTAAATATCAATGAAGTATGG + Intergenic
992095548 5:73359267-73359289 GTGTAAAGGTGACTGCTGGGAGG + Intergenic
994144646 5:96380829-96380851 GTCCAAATAGCAATGCTTGGGGG + Intergenic
997500227 5:134368088-134368110 ATTTAAATATGCATGCTGGGTGG - Intronic
999505358 5:152189108-152189130 ATGTAAACATCAGAGCTGGGAGG - Intergenic
999596496 5:153210996-153211018 GTCTTAATATCAAAGCTGGAAGG - Intergenic
1002410267 5:179069205-179069227 GTGTAGATATTAATGCTGGAGGG - Intronic
1002558532 5:180063390-180063412 GTGTAAATAACAAGGGTGGATGG + Intronic
1004925402 6:20411318-20411340 GTGTGTATATCAAGGCAGGGCGG + Intronic
1006659887 6:35632027-35632049 GTGAAAATATATTTGCTGGGGGG + Intronic
1008134129 6:47753413-47753435 GTGTAAATATAAATACTGAAAGG - Intergenic
1009211984 6:60873184-60873206 TTTTAAATATTAATGGTGGGGGG - Intergenic
1009498329 6:64378543-64378565 AATGAAATATCAATGCTGGGGGG + Intronic
1014028479 6:116675226-116675248 GTGTAAATGTGTATGTTGGGAGG + Intergenic
1015363930 6:132375721-132375743 GTGTACCTATCACTTCTGGGAGG + Intronic
1016062261 6:139643155-139643177 CTCTAAATATAAATGCTGAGAGG - Intergenic
1016475427 6:144421887-144421909 GTGAACATATCATTGATGGGTGG - Exonic
1018640845 6:165902652-165902674 GAGGAAATATCATTGCTGGTGGG - Intronic
1020984783 7:15119866-15119888 GTGTGAAAACTAATGCTGGGAGG - Intergenic
1021411748 7:20336730-20336752 GTGTCCATAGCAAAGCTGGGAGG - Intronic
1021880079 7:25086554-25086576 TTGTAAATATTAATGCTGGCCGG + Intergenic
1023489335 7:40721237-40721259 GTGTAAATATCAATGCTGGGAGG + Intronic
1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG + Intronic
1028683256 7:93563549-93563571 GTGTAAATCACAATGCAGAGTGG + Intronic
1029377180 7:100186005-100186027 GTGTAAGTAGCAACCCTGGGAGG - Intronic
1035909762 8:3553609-3553631 CTGTCATTAGCAATGCTGGGAGG - Intronic
1037874850 8:22538163-22538185 ATGTGAATAGCAATTCTGGGAGG + Intronic
1039734269 8:40314079-40314101 GTGGAAACATCAATGATGGGGGG - Intergenic
1039800390 8:40949655-40949677 GTGTACATATGAATTTTGGGAGG - Intergenic
1040621025 8:49092923-49092945 GTGTTAATGTTAATGCTGGAGGG - Intergenic
1040779476 8:51091173-51091195 GTGTTAATGTTAATGCTGGTCGG + Intergenic
1042224722 8:66506133-66506155 GTGTAAATCAGAATGCTGTGGGG + Intronic
1043402043 8:79893066-79893088 GTGAAAGTATCAAGGCTGTGAGG - Intergenic
1044891412 8:96840182-96840204 CTGTAAATATCAAAGCAAGGTGG + Intronic
1049991260 9:993945-993967 GAGTAAAACTGAATGCTGGGAGG - Intergenic
1051646818 9:19276917-19276939 GTGTGGCTTTCAATGCTGGGAGG + Intronic
1052279691 9:26718887-26718909 AGGTAAATATGAATGTTGGGGGG - Intergenic
1053487215 9:38469009-38469031 GTGTGAATGTGAATGCTGGAGGG - Intergenic
1060344552 9:122804732-122804754 TTGAAAATATCGGTGCTGGGAGG - Intronic
1185486484 X:485258-485280 GTATACATATCACTCCTGGGAGG - Intergenic
1185872969 X:3679945-3679967 CTGTAAACATTAATGCGGGGTGG + Intronic
1186830027 X:13380952-13380974 GTGTTGATATTAATGCTGGAGGG + Intergenic
1187241744 X:17520230-17520252 CTGTAAATTCCAATTCTGGGGGG + Intronic
1188951704 X:36383835-36383857 GTGTAAATCTTAATGTTAGGAGG + Intronic
1189876875 X:45445530-45445552 AAGTCAATATGAATGCTGGGTGG + Intergenic
1192970434 X:76222559-76222581 GTGTTAATGTTAATGCTGGAAGG + Intergenic
1195291924 X:103437948-103437970 GTGTTGATATTAATGCTGGAGGG - Intergenic
1200740369 Y:6847377-6847399 GTAGAAATATGAATGCTGGAGGG - Intergenic
1200938992 Y:8763126-8763148 GTGGAATTATTGATGCTGGGTGG - Intergenic