ID: 1023491273

View in Genome Browser
Species Human (GRCh38)
Location 7:40744733-40744755
Sequence TGCTCAGCAAAACTCCTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023491273 Original CRISPR TGCTCAGCAAAACTCCTTAA GGG (reversed) Intronic
900871169 1:5304394-5304416 TGCTCACCAAAATCCCTGAAAGG + Intergenic
902647208 1:17808172-17808194 TGCTCATCAAGACTCCATCAGGG - Intronic
903104461 1:21063608-21063630 TGCACAGCAAAACAACTTGAAGG + Intronic
903832381 1:26182939-26182961 TTCTCAGCAACATTCCTAAAGGG - Intronic
908906336 1:69015925-69015947 AGCTGAGGAAATCTCCTTAAGGG - Intergenic
910215167 1:84836359-84836381 TGCTCAGCAAAATTGCAGAATGG - Intronic
917078041 1:171226536-171226558 TGTTCAACAAAAATACTTAATGG - Intergenic
917804539 1:178601614-178601636 TTCTCAGCCAAACACCTTCATGG + Intergenic
919995887 1:202749808-202749830 TACTCTGAAAAACTACTTAATGG + Intronic
920272167 1:204773949-204773971 TGCTAACCAGAACTCCTTCAGGG + Intergenic
923362274 1:233223375-233223397 TTTGCAGCAAAACTCCTTGAAGG - Intronic
1063248281 10:4246801-4246823 GCTTCAGCAAAACTGCTTAATGG + Intergenic
1065787305 10:29228740-29228762 AGCACATCAAAACTGCTTAATGG + Intergenic
1066234661 10:33473993-33474015 TGCTCTGTAAAACGGCTTAAAGG - Intergenic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1069191635 10:65498374-65498396 TGCTCAGTAAATATCCTTAATGG - Intergenic
1070015366 10:72523958-72523980 TGCTCAGTAAAATGGCTTAAGGG - Intronic
1079927093 11:26507411-26507433 TGCTCAGCAAGACTGCTCTAGGG - Intronic
1081877296 11:46417772-46417794 TTCTCAGCGCCACTCCTTAAAGG - Intronic
1083051718 11:59783106-59783128 TGGTCAGCAATACTTCTTGAGGG + Intronic
1085629171 11:78098877-78098899 TGCTCAGCTGAACTGCTTTAAGG + Intergenic
1086700069 11:89891629-89891651 TTCTCAGCAACCCTCATTAAAGG - Intergenic
1086706101 11:89952887-89952909 TTCTCAGCAACCCTCATTAAAGG + Intergenic
1089246214 11:117122234-117122256 TGCTCAGTAAAATTGCTAAATGG - Intergenic
1089916836 11:122165135-122165157 TGCTCAGCTCAACTCCTGGATGG - Intergenic
1092069173 12:5618787-5618809 TGCTCAGTGAAGCTCCTTGAAGG - Intronic
1095449708 12:42317248-42317270 TGCTCACCAAAACTTCTGACTGG - Intronic
1096286408 12:50304468-50304490 TGGTCAGCATGACTCATTAATGG - Intergenic
1096356796 12:50948329-50948351 TGCTCATCAAAACTGCTGTAAGG + Intergenic
1097643815 12:62212393-62212415 TGCTTATCCAAACCCCTTAAAGG - Intronic
1098342459 12:69466942-69466964 TGTTTAACAAAACACCTTAATGG + Intergenic
1099234193 12:80062797-80062819 TGCTCAGCAAAGCTCACCAATGG + Intergenic
1099881461 12:88471977-88471999 TGCTCAGCAAAACTGCTAATTGG + Intergenic
1100612976 12:96207545-96207567 TTCTCAACAAAACTCTTTCATGG - Intronic
1100629594 12:96374492-96374514 GCCTGAGCAAAACACCTTAAGGG - Intronic
1102531425 12:113549234-113549256 TGCTCAGTAAATCTGGTTAATGG + Intergenic
1103099591 12:118161529-118161551 TGCTCAGAGAAATTCCATAATGG + Intronic
1109359145 13:61272916-61272938 TGATCAGCAAAACACATTTAGGG + Intergenic
1111672049 13:91344190-91344212 TGCATAGCAAACTTCCTTAAGGG + Intergenic
1112654342 13:101433864-101433886 TTTACAGCAAAACTCCTTTAAGG - Intergenic
1117524800 14:56588726-56588748 TGCTTAAAAATACTCCTTAAGGG - Intronic
1118116806 14:62787156-62787178 TGCACAGTAAAAGTTCTTAAAGG + Intronic
1118809591 14:69263144-69263166 TGCACAGCAAGGCTTCTTAAAGG + Intronic
1120058669 14:79955530-79955552 TGCCTTGCAAAACTCCTGAAGGG + Intergenic
1121807213 14:96839181-96839203 TGCTCAGCATAACGTTTTAATGG + Intronic
1128231998 15:66041961-66041983 TGATCAGAAAAGCTGCTTAAGGG - Intronic
1128491807 15:68154469-68154491 TTCACATCAAAAGTCCTTAAAGG - Intronic
1129056406 15:72823496-72823518 TGCTCAGCAGAAGTCATTAGGGG + Intergenic
1129980972 15:79870575-79870597 TGCTGAAAAAAACTACTTAAAGG + Intronic
1130404414 15:83585152-83585174 TGCTCAGTACAAGTCCTGAAGGG - Intronic
1130419880 15:83734648-83734670 TGCTCAGCAAATAGTCTTAAAGG + Intronic
1132194990 15:99907957-99907979 TGTCCAGGAAGACTCCTTAAAGG - Intergenic
1133699872 16:8298909-8298931 TGCTGAGTAAAACTGCTAAAGGG - Intergenic
1138203860 16:55110045-55110067 AGCTCAGCAACCCTCCGTAAGGG - Intergenic
1138716873 16:59034039-59034061 TGCTCAGAAGAAATCCTTCAAGG - Intergenic
1143345216 17:6244249-6244271 TACTGGGCAAAACTCCTCAAGGG + Intergenic
1143624089 17:8098550-8098572 TTCTAATCAAAACTCCTTAAGGG + Intronic
1146749760 17:35368027-35368049 TGCTCAGCAAACTCCCTAAAAGG + Intronic
1146991549 17:37278063-37278085 TGCACAGCAAAACTACGTAAAGG + Intronic
1148690218 17:49522860-49522882 TTCTCAGCAAAGCTCCTAGAAGG - Intergenic
1152212129 17:79008319-79008341 TTCTCAGCAAAGCTCCTCAGAGG + Intronic
1153145414 18:2026184-2026206 TAGCCAGCAAAACTCCTTGAAGG + Intergenic
1153420776 18:4902436-4902458 TGGGGAGCAAAACTCGTTAAGGG - Intergenic
1156686191 18:39649644-39649666 AGCTCAGTAAACCACCTTAAAGG - Intergenic
1158810721 18:61030856-61030878 TAAGCAGCAAAAGTCCTTAATGG + Intergenic
1167882837 19:52476385-52476407 GGCTCAGCAAAACACCTGTATGG - Intronic
925838727 2:7970531-7970553 TGCTTAGCAAAATACCTTAGTGG + Intergenic
927271983 2:21221138-21221160 TCCTGACCAAACCTCCTTAATGG - Intergenic
929244502 2:39686816-39686838 TGCTTAGGAAAACTGCCTAATGG + Intronic
930171265 2:48254136-48254158 TTTGCATCAAAACTCCTTAAAGG - Intergenic
932298062 2:70643159-70643181 TGCCCAGCAAACCTGCTTAGGGG - Intronic
933473192 2:82754347-82754369 TGCTCCTCAGAACTCCTTAAAGG + Intergenic
934581064 2:95439017-95439039 TCCTCAGCAATCCTCATTAAAGG + Intergenic
934598386 2:95637697-95637719 TCCTCAGCAATCCTCATTAAAGG - Intergenic
935295186 2:101643389-101643411 TGCACAGGAAAACTTCTTGAAGG - Intergenic
935759934 2:106311121-106311143 CTTTCAGCAAAACTCCTTGAAGG + Intergenic
939143661 2:138386686-138386708 TTCTCAACAAAACTTCTAAATGG - Intergenic
943014084 2:182490292-182490314 TTTACAGTAAAACTCCTTAAAGG - Intronic
943792060 2:191944338-191944360 TCCTCAGCTAAATTCTTTAAAGG + Intergenic
945362544 2:208908608-208908630 TTCTCAGCAGAACACCTAAAAGG + Intergenic
945750890 2:213781098-213781120 TACTCAGCAAAACTCCTTTAAGG + Intronic
946084743 2:217159380-217159402 TGCACAGAAAAACTTCTGAATGG - Intergenic
1174389659 20:50210369-50210391 TGCTCAGGAACACTCTTTGAGGG + Intergenic
1176048379 20:63104042-63104064 GGCTCAGCAAACCTCTTAAATGG - Intergenic
1178195925 21:30345018-30345040 TGCAAAGGAAAAGTCCTTAAAGG + Intergenic
953232574 3:41077791-41077813 GGCTCAGTAAAGCTCCTTGATGG + Intergenic
954174433 3:48832815-48832837 TGCTCAGCAAAAATCAATCAAGG - Intronic
955660298 3:61291811-61291833 TGTTCATCCAAATTCCTTAAAGG - Intergenic
958541442 3:95480103-95480125 TGCTTAGCCAAACTCCCAAAGGG + Intergenic
960641145 3:119824613-119824635 TTGGCAGCATAACTCCTTAAAGG - Intronic
962391981 3:134980023-134980045 TGCATAGCAAAACACCTCAATGG + Intronic
964813605 3:160692777-160692799 TGCAAAGAAAAAGTCCTTAAAGG + Intergenic
964844307 3:161029000-161029022 TGCTCACCATAAGTGCTTAAAGG - Intronic
964912158 3:161796355-161796377 GAATAAGCAAAACTCCTTAAAGG - Intergenic
967213114 3:187186322-187186344 AGCACAGCAATACTCCTTCATGG + Intergenic
970223529 4:13834471-13834493 TCCTCCTCAAAACTCCTTAGAGG - Intergenic
972170340 4:36337667-36337689 TTCCCATCAAAACTTCTTAATGG + Intronic
974732991 4:65894419-65894441 TGCAAATCAAATCTCCTTAAAGG + Intergenic
977087399 4:92619841-92619863 AGCTCAGCAAATCTCCTTAAAGG - Intronic
979726151 4:123963916-123963938 TTCTCAGCAAAGCTCTTTCAGGG - Intergenic
980638798 4:135544877-135544899 TGCTTAGCAAAACTCTCTAAAGG - Intergenic
980875972 4:138662483-138662505 TGCTCATCTAAAGTCCTCAAGGG - Intergenic
981417924 4:144514915-144514937 TTCTCAGCAAAATTCCAAAATGG - Intergenic
981451145 4:144899271-144899293 TGCATAGCAAAACCCCTAAAAGG - Intergenic
981653099 4:147081158-147081180 TGCCCTGCAATAGTCCTTAAAGG - Intergenic
983410883 4:167396401-167396423 TGCTCAGCAAATTTTTTTAAAGG + Intergenic
984209419 4:176827185-176827207 TGCTCTGCAAAAATGCTAAAGGG + Intergenic
984637387 4:182125654-182125676 TTTTTAGGAAAACTCCTTAAAGG - Intergenic
984866671 4:184286551-184286573 TGCTCAGCAACATTTCTGAAGGG + Intergenic
985017325 4:185650345-185650367 TGCTCACCGAAACTCATTCAGGG - Intronic
985711522 5:1432256-1432278 AGCTCAGCAAAGCTCCTGTAGGG - Intronic
988206662 5:28145137-28145159 TTCACAGTAAAACTCCTTGATGG + Intergenic
991601806 5:68358471-68358493 TGTTTAGCAAAACACCCTAAAGG - Intergenic
998562778 5:143186752-143186774 TGCACAGCAAAGCTCCCCAATGG - Intronic
999419800 5:151431065-151431087 TCCTAAGCATAACTCCTTAGAGG - Intergenic
1000219930 5:159204897-159204919 TTCTCAGCAAAATTCTTAAAAGG - Intronic
1006417618 6:33913951-33913973 TGCTGAGCAAAATTCCACAAAGG + Intergenic
1006593865 6:35178574-35178596 ACCTCAGGAAAACTTCTTAAAGG - Intergenic
1007466078 6:42052208-42052230 TCCCCAACAAAAGTCCTTAAGGG - Intronic
1009439967 6:63666229-63666251 TATTCAGCAAAGCTCTTTAATGG - Intronic
1011207751 6:84918558-84918580 TTCTCATCAAAACTCTTTGAGGG - Intergenic
1011232636 6:85179865-85179887 TGCTTAGCAAATCTTCTTATTGG + Intergenic
1012532132 6:100250807-100250829 TCCTGATTAAAACTCCTTAATGG - Intergenic
1012956865 6:105580239-105580261 TTCAAAGCAAACCTCCTTAAGGG + Intergenic
1013389923 6:109674649-109674671 TGCTCATCAAAATTACTAAATGG - Intronic
1014101212 6:117513989-117514011 TGCTCCGCCAGACTCCTTTAAGG - Intronic
1014811613 6:125893070-125893092 GGCTCAACAGAAGTCCTTAAGGG + Intronic
1015357384 6:132294884-132294906 TGCTCAGCCAAACTCATTATTGG - Intergenic
1015630094 6:135223382-135223404 TCCTCAGCAAAACTGCTTAAGGG + Intergenic
1017135939 6:151147496-151147518 ATCTCAGCAAAAGTCCTCAAAGG + Intergenic
1018881385 6:167885276-167885298 TGCAAAGGAAAACTTCTTAAAGG - Intronic
1018973135 6:168542900-168542922 TGCCCAGTAAAACTCCTCAGGGG - Intronic
1019200462 6:170310214-170310236 TGCTCTACAAAACCCCTTAGAGG - Intronic
1021798286 7:24279480-24279502 AGCTCAGAAAAACTCCATCAAGG - Intergenic
1023491273 7:40744733-40744755 TGCTCAGCAAAACTCCTTAAGGG - Intronic
1024502064 7:50120421-50120443 TGTTCAGCAAAAACACTTAATGG + Intronic
1027635104 7:80662020-80662042 AGCTCAGCAAAAACTCTTAAGGG + Intronic
1028504849 7:91559572-91559594 TGCTCAGGGAAACCCTTTAATGG - Intergenic
1028526835 7:91795847-91795869 TCTTCAGTAAAACTACTTAAAGG + Intronic
1029323560 7:99786101-99786123 TGCTCAGCAAAGCCACTGAAAGG - Intergenic
1031592864 7:123614629-123614651 TCCTCAGCAAAATTTCTTTATGG + Intronic
1036790611 8:11716353-11716375 TGCACAGGAAAACTGCTTTAAGG + Intronic
1037654104 8:20868156-20868178 AGCTCTGCAAGACCCCTTAAAGG + Intergenic
1041540320 8:58977502-58977524 TGCAAAGGAAAAGTCCTTAAAGG - Intronic
1042967120 8:74365490-74365512 TGCTCAGAAAAAGTCTTTCATGG + Exonic
1044481754 8:92698737-92698759 TGCATGGCAAAACTCCTTAAAGG - Intergenic
1045073148 8:98532079-98532101 TGCAAAGAAAAACTTCTTAAAGG - Intronic
1045658508 8:104411708-104411730 TGCTCAGCAATACCCCTCATGGG + Intronic
1045833942 8:106497953-106497975 TGCTCAGGAAAACTGATTTATGG + Intronic
1045967918 8:108047487-108047509 TGCTCAGGAAAATTCTTGAAAGG + Intronic
1047576635 8:126162755-126162777 TGCACAGCATATGTCCTTAATGG - Intergenic
1051435453 9:17026245-17026267 TGTTCAGCCAAAATTCTTAAAGG + Intergenic
1051855861 9:21564464-21564486 TGCTCAGTAAGACTCCATAGAGG + Intergenic
1053341552 9:37339363-37339385 ACCTCAGAAAAACACCTTAAAGG + Intronic
1056434030 9:86557709-86557731 GGCTCAGCAAAAGTCAGTAAAGG + Intergenic
1058817378 9:108696998-108697020 TGCTCAGCAAAACACATAAACGG - Intergenic
1058940749 9:109810619-109810641 TTTACAGCAAAACTCCTTGAAGG - Intronic
1060036686 9:120261855-120261877 TCCTCAAGAAAACTTCTTAATGG - Intergenic
1062229228 9:135472189-135472211 TGCTCAGTCACACTCCTGAAAGG - Intergenic
1191228132 X:58067401-58067423 TGCTCAGAAATATTCCTTTATGG + Intergenic
1192950742 X:76013856-76013878 TTCTCAATTAAACTCCTTAAAGG - Intergenic
1193043905 X:77032305-77032327 TTCTCAGCAGAAATCCTTATAGG + Intergenic
1194859156 X:98974116-98974138 TGCTCAGCAAAATTACTTGAGGG + Intergenic
1194934327 X:99929301-99929323 TTTTCAGCAAAACACCTTATTGG - Intergenic
1196141441 X:112267163-112267185 TTCTTAACAAAACTCCTCAAAGG + Intergenic