ID: 1023491362

View in Genome Browser
Species Human (GRCh38)
Location 7:40746063-40746085
Sequence CATTTCCAATGAAGTTTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023491358_1023491362 18 Left 1023491358 7:40746022-40746044 CCAAAAAATGTTATACAAATGGT 0: 1
1: 0
2: 4
3: 61
4: 558
Right 1023491362 7:40746063-40746085 CATTTCCAATGAAGTTTAGAGGG 0: 1
1: 0
2: 1
3: 28
4: 227
1023491356_1023491362 25 Left 1023491356 7:40746015-40746037 CCATTCACCAAAAAATGTTATAC 0: 1
1: 0
2: 0
3: 21
4: 228
Right 1023491362 7:40746063-40746085 CATTTCCAATGAAGTTTAGAGGG 0: 1
1: 0
2: 1
3: 28
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023491362 Original CRISPR CATTTCCAATGAAGTTTAGA GGG Intronic
901393006 1:8959624-8959646 CATTTCTAAGAAAGTCTAGATGG + Intronic
902888332 1:19423141-19423163 CATTTCCAATTAAGATTAATTGG - Intronic
905578780 1:39067528-39067550 CATTAACTATGAAGTTTGGATGG - Intergenic
906181196 1:43821122-43821144 CCTTTCCAATCAAGCTTATAAGG - Intronic
908176212 1:61557581-61557603 CATTTCCAAACAAATTCAGAAGG + Intergenic
909495741 1:76276251-76276273 CATTGCTAAGGAAGTTTAAAAGG - Intronic
909595324 1:77399806-77399828 TATTTGCAAAGAGGTTTAGAAGG + Intronic
910726298 1:90343397-90343419 CATTTCCACTGAAGTTGATGGGG - Intergenic
911639368 1:100270612-100270634 CCTTTCAAATGAAGTTCTGATGG - Exonic
912887634 1:113491972-113491994 CTATTCCAATGAAGTTAAGGAGG + Intronic
915706492 1:157848838-157848860 CAGGTCCACTGAAGTTTAGAGGG + Intronic
915879651 1:159653933-159653955 AATTTAAAATGAATTTTAGATGG - Intergenic
916817133 1:168365023-168365045 CCTTTCCACTGATGTTTTGATGG - Intergenic
917681532 1:177373012-177373034 AATTTCCAAAGAAATTTAGAAGG - Intergenic
918425737 1:184407938-184407960 CATCTGCAATGAAGTTTATATGG - Intronic
918688264 1:187446741-187446763 CATTTACTATGATGTTTATAAGG + Intergenic
919710903 1:200726988-200727010 CAATTCCAAAGAATTTTAAAAGG - Intergenic
920666436 1:207966017-207966039 CATGTCCAAGGAAGGTTAGCAGG - Intergenic
921245835 1:213239034-213239056 TATTTCAACTGAAGTTTAAAAGG - Intronic
1064793254 10:18983215-18983237 CATTAGCAAGGAAGTTTAAAGGG - Intergenic
1065368848 10:24961288-24961310 TATTTCAAATGATGTTTATAAGG - Intergenic
1066306580 10:34149955-34149977 CTGTTCAAATGAAGTTTACAAGG - Intronic
1068068135 10:52159179-52159201 CATTTCAAATGAAATTTATAGGG + Intronic
1068836676 10:61562714-61562736 CTTATCCAATTAAGTTGAGAAGG + Intergenic
1069299078 10:66884221-66884243 AATTTCATATGAAGTTTAAAGGG + Intronic
1069772863 10:70910620-70910642 AATTTCCAGTGAGATTTAGAGGG + Intergenic
1070223283 10:74473780-74473802 CATTTCTAATGAACTGTATATGG - Intronic
1071203842 10:83251902-83251924 CATTTCCCATGAGATTTGGAGGG + Intergenic
1072030243 10:91512848-91512870 CATTGCAAATGCAGTTTACAGGG + Exonic
1072548390 10:96457894-96457916 CATTGCCGATGATGTTTAGTGGG - Intronic
1073361186 10:102900272-102900294 CAGTTCCAAAGAGGTTTAAAAGG + Intronic
1075024426 10:118974066-118974088 CATTTTCAAGGAAAGTTAGAGGG + Intergenic
1076281037 10:129246179-129246201 CATTTCCAGTAAGGTTTTGAAGG + Intergenic
1079752240 11:24213484-24213506 AATTTCAAATGAAGTTTATGTGG - Intergenic
1082200725 11:49363398-49363420 CATTTCCATTGCAGTTAAGAAGG + Intergenic
1084136933 11:67191016-67191038 CTTTTCCAAAGAATTTAAGAGGG + Intronic
1086177086 11:83903834-83903856 CATTTCCACTGAAGATAAGAAGG - Intronic
1086347930 11:85916665-85916687 CATTTCCAAGGTGGTTTATATGG + Intronic
1086654945 11:89342857-89342879 CATTTCTATTGCAGTTAAGAAGG - Intronic
1086836334 11:91628211-91628233 CAGTTGCAATGTGGTTTAGAAGG + Intergenic
1086895166 11:92303868-92303890 CTATTCAAATGTAGTTTAGAGGG + Intergenic
1087269469 11:96096918-96096940 CATGCCCAGTGAAGTTTTGATGG - Intronic
1088774991 11:113074014-113074036 CATTTGTAATGAAATTTAGAAGG + Intronic
1091940817 12:4479606-4479628 CATTTCAAATGAATTTTAAAAGG + Intergenic
1093326163 12:17777391-17777413 CATATCCAATGAACTTGAGCTGG - Intergenic
1093639233 12:21506418-21506440 CATTTCTAATGCAGTAAAGAAGG + Intronic
1093830242 12:23747171-23747193 AATTTCCAATGAATTATATAGGG - Intronic
1094129291 12:27058075-27058097 CATTTTTAATGAAGTATTGATGG + Intronic
1094447031 12:30542646-30542668 CATTTCCAATTGAGTTTATTTGG + Intergenic
1095533744 12:43221875-43221897 GGTTTCCAATGAATGTTAGAAGG + Intergenic
1097007688 12:55931088-55931110 CATTTTCAATGAAGGGTAGGAGG + Exonic
1097908177 12:64942121-64942143 CATTTCCTTTGAATTCTAGAAGG + Intergenic
1099423144 12:82489025-82489047 GATTTTCAATGAAGTTTTGGTGG - Intergenic
1101140869 12:101794680-101794702 TCTTTCTAAAGAAGTTTAGAAGG - Intronic
1104587159 12:130056661-130056683 CAGTTCAACTGAGGTTTAGAAGG + Intergenic
1106513561 13:30432831-30432853 CATATCCTTTGAACTTTAGAGGG - Intergenic
1107267748 13:38577607-38577629 CATTTCCAATAAAGTGGAGATGG + Intergenic
1108034081 13:46269578-46269600 CTTTTACAAGGAAGTGTAGAAGG + Intronic
1108568239 13:51723218-51723240 TATTTTCAATGAAGTATATAAGG - Intronic
1109520721 13:63506759-63506781 CATTTTCAATAAGGTTGAGATGG - Intergenic
1110632335 13:77723559-77723581 CATTTCCCACAGAGTTTAGAAGG + Intronic
1110881381 13:80577079-80577101 CATAGCCACTGAAGTTTAAATGG + Intergenic
1113451793 13:110415446-110415468 CATTTCAAATAAAGATAAGAGGG + Intronic
1114581789 14:23767622-23767644 CATTTCCCATAGTGTTTAGATGG - Intergenic
1115214746 14:31003411-31003433 AATTTCAAATGAGGTTTGGAGGG - Intronic
1115580089 14:34749028-34749050 CATCTCTAATGACATTTAGATGG - Intergenic
1116934779 14:50728380-50728402 TATTTCTAATAAACTTTAGAAGG - Intronic
1117103544 14:52375494-52375516 CATTTCTAATTGAGTTTAGTTGG + Intergenic
1117780677 14:59228539-59228561 CATTTCGAATGAATGTTAAAAGG + Intronic
1118919470 14:70136991-70137013 CATCTCCTATGAAGTATAGAAGG + Intronic
1120451446 14:84672333-84672355 CATTTGTAATGAAGTTTCTAAGG - Intergenic
1120778373 14:88462417-88462439 CATTGCCAAAGAAATTCAGAAGG - Intronic
1121170448 14:91849641-91849663 CAGTTCCAAAGAATCTTAGAGGG - Intronic
1202845363 14_GL000009v2_random:167614-167636 CATTTCCCATGAAGTTCCCATGG + Intergenic
1126620954 15:50639303-50639325 CTTTTCAAATTAAGTTTAAAAGG - Intronic
1127620516 15:60729225-60729247 CTTTGTCAATGAAGTTTTGATGG - Intronic
1129304187 15:74646857-74646879 AATTTCAAATGAAATTTTGAAGG + Intronic
1130295144 15:82641926-82641948 AATTTCCAATGAATTTTATTAGG - Intronic
1131748832 15:95482829-95482851 CATTTACAGGGACGTTTAGAAGG + Intergenic
1134648072 16:15886829-15886851 CCTTTCCGAAGAAGTTTTGATGG - Intronic
1136119699 16:28124452-28124474 CATTTGCACTGAGGTTTAGCAGG - Intronic
1139078664 16:63486697-63486719 CATTTCCACTGAGGTTCACAAGG + Intergenic
1140795721 16:78435634-78435656 CATTTCCCTTGTAGTTGAGATGG + Intronic
1141029419 16:80574709-80574731 CATTTCCCATGGAGTCTAGAAGG - Intergenic
1142406967 16:89895516-89895538 TATTTACAATGAAGTTTTCAAGG + Intronic
1143241813 17:5449946-5449968 AAGTTCCAATTAAGTTTTGATGG + Intronic
1146490176 17:33275413-33275435 ACTTTCCACTGAAGTCTAGAAGG - Intronic
1146670611 17:34734914-34734936 CATCTCTATTGAAGTTAAGAGGG - Intergenic
1146682125 17:34815976-34815998 CATTTCCAAGGCTGTTTTGAAGG + Intergenic
1148133945 17:45279850-45279872 GATGTCCAATGAATATTAGAGGG + Intronic
1151233969 17:72704966-72704988 CATTTCTAATGGTGTTAAGATGG - Intronic
1151441518 17:74132370-74132392 CATTTCCATTGGAGTTGATAGGG - Intergenic
1151691098 17:75686007-75686029 CATTTACATTGAAGTCTAGTTGG + Intronic
1155846177 18:30709690-30709712 CATTTCCAATAAAGCTTTCAGGG + Intergenic
1155865355 18:30958111-30958133 CATCTGCAATGCACTTTAGAAGG + Intergenic
1156778163 18:40819043-40819065 CATTTCCCATCTAGTTGAGATGG - Intergenic
1158064474 18:53389078-53389100 CATTCAAAATGAACTTTAGATGG - Intronic
1165178855 19:33950470-33950492 CATTTCAAATGAAAAATAGAAGG + Intergenic
1166174417 19:41056044-41056066 CATTTCTATAGAAATTTAGAAGG - Intergenic
1167884711 19:52491279-52491301 CGTTTCCAATTAAGTCCAGATGG - Intronic
1167890063 19:52532863-52532885 CGTTTCCAATTAAGTCCAGAAGG - Intronic
1167892598 19:52553062-52553084 CATTTCCAATTAAGTACAGATGG - Intronic
1167911505 19:52706887-52706909 CATTTCCAATTAAGTACAGATGG + Intronic
1167914460 19:52728854-52728876 CGTTTCCAATTAAGTCCAGACGG + Intronic
1167923240 19:52801725-52801747 GGTTTCCAATGAAGTACAGATGG + Intronic
1168493685 19:56832855-56832877 CATTGCCATTGAAGTCTGGATGG + Intronic
926589829 2:14728737-14728759 CATTTGAAATGAATTTTAAATGG - Intergenic
927234770 2:20861241-20861263 AATTTACAGTGAAGTTTGGAGGG + Intergenic
927301441 2:21520449-21520471 GATTTTGAGTGAAGTTTAGAGGG + Intergenic
927440721 2:23114999-23115021 CACTTCCAAGGAAGGTAAGAAGG + Intergenic
928454202 2:31404569-31404591 CATTTCCATTGTAGTTTTGAAGG - Intronic
928560713 2:32482064-32482086 CAGCTCGGATGAAGTTTAGATGG - Intronic
928829198 2:35458647-35458669 TATTTCCACCGAAGTATAGAAGG - Intergenic
928889440 2:36186080-36186102 CATTTCAAATAAAGTTTTCAGGG - Intergenic
930842817 2:55866327-55866349 CAGTTCCAATGTGGTTTAGAAGG + Exonic
931091918 2:58895535-58895557 CATTTCAAATGAATATCAGAAGG - Intergenic
932716564 2:74104518-74104540 CATTTAAAATGAAGTTTTCAAGG - Exonic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
933839399 2:86274530-86274552 CATTTCCTAGTAATTTTAGATGG - Intronic
934631291 2:95926327-95926349 CATTTTCAATGAATATTGGAGGG - Intronic
935016199 2:99184454-99184476 CATTTCCAATCTAGTATATAAGG + Intronic
936556341 2:113500931-113500953 CAGTTCCAAGGAAGTGAAGAAGG - Exonic
938944099 2:136195259-136195281 CATTTAAAAGGATGTTTAGAGGG - Intergenic
939331909 2:140774423-140774445 TAATTCCAATGAAGTTTTTAGGG - Intronic
939872797 2:147543478-147543500 AAATTCCTATGAAATTTAGAAGG + Intergenic
942040051 2:172051777-172051799 CACCTCAAATGAAGTTGAGATGG - Intronic
942728422 2:179036250-179036272 CATAACCAATGAAGTGTTGATGG - Intronic
943289028 2:186044057-186044079 AATTTCAAATGAATTTTGGAAGG + Intergenic
943307493 2:186282260-186282282 CATTTACACTGAAGCTTACATGG - Intergenic
943689173 2:190851386-190851408 CATTTTTAAAGAAGTCTAGAAGG - Intergenic
943810086 2:192174571-192174593 GATTTCAATTGAAGTTCAGATGG + Intronic
945759804 2:213901021-213901043 ATTTTCCAAAGAAATTTAGAAGG + Intronic
946406549 2:219495099-219495121 CATTTCCAATGGAGATGGGAAGG - Intronic
947316997 2:228870833-228870855 CAATTCCACTGAAGTTTAGTTGG - Intronic
948556005 2:238811557-238811579 CATTTCAAGTGATGTTTACAAGG + Intergenic
1169678666 20:8184350-8184372 CATTTCTTATGAACTTTAGAGGG - Intronic
1171220840 20:23395966-23395988 CATTTTTTATGTAGTTTAGAGGG - Intronic
1172636690 20:36414754-36414776 CATTTCCCATGAGGCTTACATGG - Intronic
1172735198 20:37121644-37121666 CATTTCCCCAGGAGTTTAGAAGG + Intronic
1172851170 20:37966261-37966283 CATTTCTAATTAAGTTTATTTGG + Intergenic
1172887913 20:38244160-38244182 CAGTGCAAATGAAGTTTAAATGG + Intronic
1173361204 20:42346219-42346241 CATTTCCAAGGAAGTCTTCAGGG + Intronic
1175265738 20:57702426-57702448 CATTTCCAATGAATGTCAGCCGG + Intronic
1175723179 20:61299943-61299965 CATTTGTAATGATGTGTAGAGGG + Intronic
1175809093 20:61847958-61847980 CATTTCAAATGAGATCTAGAAGG + Intronic
1177740902 21:25152625-25152647 CTTTTCTAATGAATTTCAGAAGG + Intergenic
1180507842 22:16034363-16034385 CATTTCCAATGAAGGTCTCAAGG + Intergenic
1180973961 22:19834589-19834611 CATTTCAAATAAAATATAGAAGG - Intronic
951198417 3:19850656-19850678 CATTTCTAATAAAGTTTATTTGG - Intergenic
954561907 3:51563950-51563972 CACTTCCTGTCAAGTTTAGAAGG + Intronic
955181860 3:56679705-56679727 CATTTCCCAAGAACTTTGGAGGG + Intronic
955843295 3:63135029-63135051 CATTCTCAATTAACTTTAGATGG + Intergenic
956649159 3:71487478-71487500 CATTTACAATGCAGTGTATAAGG - Intronic
957996089 3:87691786-87691808 CATTTACAATGAAGTTAACAAGG + Intergenic
958527445 3:95281518-95281540 AATTTCCAATGAATCTTATAGGG + Intergenic
961575893 3:127836102-127836124 TGTTTCCAAAGCAGTTTAGAGGG - Intergenic
963478806 3:145841265-145841287 CAGTTCCACTGTAATTTAGAGGG - Intergenic
965176372 3:165339064-165339086 AAGTTCCGATGAAGTATAGAGGG + Intergenic
966021822 3:175222158-175222180 CATTGCCAAAGAAGTTAAGATGG + Intronic
968536762 4:1135973-1135995 AATTTCCAAGTAAGTTTACAGGG + Intergenic
970342193 4:15118899-15118921 CATTTCCTTTGAAGGGTAGAGGG + Intergenic
971810706 4:31422719-31422741 CATTTCAAATAAAGTTTAGATGG - Intergenic
972230883 4:37071666-37071688 CATTTGCAAGGTATTTTAGAAGG - Intergenic
973128580 4:46620682-46620704 CATTTCAAATGAGATTTGGAGGG - Intergenic
974406019 4:61470748-61470770 CATTTAAAATGAAGTTGATAAGG + Intronic
978159907 4:105533669-105533691 CATTTTCTATGAGGTTAAGAAGG - Intergenic
978648024 4:110964583-110964605 AATTTCCAAAGCAGTTTATATGG + Intergenic
978698372 4:111611596-111611618 CATTTGCAATGAAATCTAGTGGG + Intergenic
979977854 4:127218866-127218888 AATTTCCCATGAATTTTAGATGG - Intergenic
981897918 4:149825752-149825774 CTTTTATAATGAAGTTGAGAAGG - Intergenic
982627298 4:157783729-157783751 CATTTCCAATAATATTTAGTAGG + Intergenic
982879242 4:160690258-160690280 CATTTCCGATTATGTTTATATGG - Intergenic
983434336 4:167692979-167693001 AATTTCCCAAGAAGTTCAGAAGG - Intergenic
984925311 4:184801311-184801333 CTTGTCCAATAAAGTTTACACGG - Intronic
985180630 4:187257821-187257843 CATTTACACTGAAGTCCAGAAGG - Intergenic
987000695 5:13656399-13656421 TATTTCAAAAGAGGTTTAGAAGG - Intergenic
987211331 5:15686673-15686695 AATTTTCAATGTAATTTAGAAGG + Intronic
989037204 5:37187596-37187618 CATTTCCTTTTTAGTTTAGATGG + Intronic
989274680 5:39573746-39573768 AATTTAGAATGGAGTTTAGAAGG - Intergenic
989472420 5:41835966-41835988 CATTTCCAGAGAAACTTAGATGG + Intronic
989750385 5:44885449-44885471 CATTTCCAGTGAAATTTCTATGG - Intergenic
991130167 5:63113271-63113293 CATCTCCAAAGAAATCTAGAGGG - Intergenic
991172789 5:63647821-63647843 CATGTTCAAGGAAGTTCAGAAGG - Intergenic
991964912 5:72081233-72081255 CATTTCTAATGCAGTAGAGAAGG + Intergenic
992666678 5:79016656-79016678 CAATTCCAATAAAGTCTAGCAGG + Intronic
992884253 5:81142177-81142199 GATTTCCAATGGAGTGTAGATGG + Intronic
992942190 5:81773380-81773402 CATTTCCAATGAGGATTGGGAGG - Intergenic
993096223 5:83481961-83481983 CTTTTCCAATGAAGTTTTTCAGG + Intronic
993178865 5:84522546-84522568 CATTTCAAATGAAGATTAAAAGG - Intergenic
994257841 5:97621136-97621158 CATTTCCAATTATGTTTATTTGG + Intergenic
994536160 5:101031855-101031877 AATTTCCTAAGAGGTTTAGAAGG + Intergenic
995243353 5:109910554-109910576 GATTTTCAAAGAAATTTAGATGG - Intergenic
997612613 5:135225837-135225859 GATTTGAAATGAAGTTTAAAGGG - Intronic
999843888 5:155457538-155457560 CATTTCCAGCAAACTTTAGAAGG + Intergenic
999871226 5:155753426-155753448 GATTGACAATGAAGTATAGAAGG - Intergenic
1000538956 5:162514949-162514971 CATTTTCAATGAAGTTGCCAAGG - Intergenic
1000599605 5:163256321-163256343 CTTTTTCCATGAAGTTCAGATGG - Intergenic
1002543265 5:179920338-179920360 CATGTCCAAAGAAGGTTCGATGG + Intronic
1003298692 6:4856795-4856817 CTTTTCCAATGAGGTGTAAAAGG - Intronic
1004131040 6:12920304-12920326 AATTTCCAATAAATTGTAGAAGG + Intronic
1004887163 6:20062313-20062335 CTATTCCAAAGAAGGTTAGAAGG + Intergenic
1005259213 6:24039707-24039729 CATTTCTAATTAAGTTTACTTGG + Intergenic
1005797031 6:29375167-29375189 CATTTCCAATCAAGTTTATCAGG + Exonic
1007127664 6:39441006-39441028 CATCTCCAAGAAAGATTAGATGG + Intronic
1009360719 6:62808911-62808933 CATCTCTAATGAAATTTAGGAGG - Intergenic
1009485315 6:64214714-64214736 CATTGACAATTAGGTTTAGAGGG - Intronic
1009744085 6:67790387-67790409 CATTGTCAAGGAAATTTAGAGGG + Intergenic
1011572358 6:88752707-88752729 AATGTACAATTAAGTTTAGATGG - Intronic
1012044408 6:94251677-94251699 CATTTCCAATGAACTTTGTATGG - Intergenic
1013214865 6:108018148-108018170 CTTTTCCAAGGAAGTTAACAGGG - Intergenic
1013753385 6:113433296-113433318 CATTTTCAAGGATGTTTAGAGGG - Intergenic
1014391279 6:120868669-120868691 CTTTTCCACTGCAGGTTAGATGG + Intergenic
1015537565 6:134282010-134282032 CATTTCCTATAAGGCTTAGAGGG - Intronic
1016654066 6:146497479-146497501 CATTGCCAATGAATTCTAAAAGG + Intergenic
1016997743 6:149972223-149972245 CATTTCTATTGAAGATTAGATGG - Exonic
1017000526 6:149993978-149994000 CATTTCTGTTGAAGATTAGATGG + Intergenic
1018337468 6:162809536-162809558 CATTTCTAACAAAGCTTAGAAGG - Intronic
1019041032 6:169105906-169105928 CATTTCAAAAGAAATTAAGAGGG + Intergenic
1021175325 7:17443284-17443306 CTTTTCCTTTGAAGTTTACAGGG - Intergenic
1022668556 7:32433354-32433376 AATTTCCAAGAAAGTTCAGAGGG + Intergenic
1023491362 7:40746063-40746085 CATTTCCAATGAAGTTTAGAGGG + Intronic
1025641301 7:63373233-63373255 CATTTCCAAACAGGTTTATAGGG + Intergenic
1027541916 7:79477542-79477564 CATAAGCAATGAAGTTTTGAGGG + Intergenic
1030797621 7:113808377-113808399 CATTTACAAAGAATTTTACAAGG + Intergenic
1031019771 7:116614458-116614480 AATTTCATGTGAAGTTTAGATGG + Intergenic
1031041911 7:116847436-116847458 CAATTTCACTGATGTTTAGAAGG + Intronic
1032352129 7:131174438-131174460 CCTTTCCAAGGAACTTTCGAAGG - Intronic
1033200339 7:139362837-139362859 AATCTCCAATGAATTTTAAAAGG - Intronic
1033566782 7:142586490-142586512 CTTTTCCAATGAACTATGGAAGG - Intergenic
1035993156 8:4514963-4514985 CATTTCCACTGAGGCTTAAAAGG - Intronic
1036031312 8:4977317-4977339 CGTTTTCAATCAAGGTTAGAAGG - Intronic
1036050965 8:5196369-5196391 CACATCCAATGGAGGTTAGATGG - Intergenic
1038258850 8:25975306-25975328 CATTCTCGATGAAGTTTAGTTGG + Intronic
1038464537 8:27749052-27749074 CATTTCATATGAAATTCAGAGGG - Intronic
1038994415 8:32905586-32905608 CACTTCTAGTTAAGTTTAGAGGG + Intergenic
1039975114 8:42356907-42356929 TATTTACAAATAAGTTTAGATGG + Intronic
1040944889 8:52874131-52874153 CAGTTACAATGAACTTCAGATGG - Intergenic
1041231882 8:55760675-55760697 CATTTCTAAAGTAGTTTATAAGG + Intronic
1041550040 8:59090447-59090469 TATTTCTAATTAAATTTAGAAGG + Intronic
1042729325 8:71914191-71914213 CAGTTCCAACGAGGTCTAGAAGG + Intronic
1043531100 8:81150912-81150934 TATTTCTAATTAAGTTTAGTTGG - Intergenic
1046745655 8:117873369-117873391 AATTTCCCATGAAGTTGAGAGGG + Intronic
1046979278 8:120319009-120319031 CATTTTCAATGATGTTTAATCGG + Intronic
1047100466 8:121669931-121669953 CTTTTACAAAGAGGTTTAGATGG - Intergenic
1047321828 8:123793153-123793175 CATCACCAATGAAGGGTAGATGG - Intronic
1047534257 8:125704688-125704710 CATTACCAATGAAGTATAAAGGG - Intergenic
1049896681 9:116433-116455 CAGTTCCAAGGAAGTGAAGAAGG + Exonic
1053485942 9:38456407-38456429 CTTTTCCAATGAAGTAATGATGG + Intergenic
1060906699 9:127313442-127313464 CGTTTCCAATGTAGTTCTGATGG - Exonic
1187078422 X:15960019-15960041 CATTACCAATGAAGTTAATTTGG - Intergenic
1193676715 X:84463538-84463560 CATTTCTCATGGATTTTAGAAGG - Intronic
1193819710 X:86147620-86147642 CATTTCCTATCAATTTTAGCGGG + Intergenic
1194014477 X:88602345-88602367 CATTTCAAATTGAGCTTAGATGG + Intergenic
1195443156 X:104921018-104921040 CATTCCCAAGGAAGTGTTGAGGG + Intronic
1196593915 X:117521378-117521400 AATTTCAAATGAATTTTGGAGGG - Intergenic
1196748561 X:119094047-119094069 CATTTCCAGGGTATTTTAGAGGG - Exonic
1197287314 X:124611129-124611151 CATGTGCAATGCAGTTCAGAAGG + Intronic