ID: 1023495251

View in Genome Browser
Species Human (GRCh38)
Location 7:40788167-40788189
Sequence GGGTATCGTGGAGACCAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023495243_1023495251 12 Left 1023495243 7:40788132-40788154 CCCAGTAGTATTGAGGAGTCATT 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1023495251 7:40788167-40788189 GGGTATCGTGGAGACCAAATGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1023495240_1023495251 18 Left 1023495240 7:40788126-40788148 CCCCTGCCCAGTAGTATTGAGGA 0: 1
1: 0
2: 0
3: 20
4: 146
Right 1023495251 7:40788167-40788189 GGGTATCGTGGAGACCAAATGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1023495238_1023495251 21 Left 1023495238 7:40788123-40788145 CCACCCCTGCCCAGTAGTATTGA 0: 1
1: 0
2: 1
3: 30
4: 153
Right 1023495251 7:40788167-40788189 GGGTATCGTGGAGACCAAATGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1023495237_1023495251 30 Left 1023495237 7:40788114-40788136 CCTGAAGTTCCACCCCTGCCCAG 0: 1
1: 1
2: 5
3: 29
4: 401
Right 1023495251 7:40788167-40788189 GGGTATCGTGGAGACCAAATGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1023495241_1023495251 17 Left 1023495241 7:40788127-40788149 CCCTGCCCAGTAGTATTGAGGAG 0: 1
1: 0
2: 2
3: 18
4: 111
Right 1023495251 7:40788167-40788189 GGGTATCGTGGAGACCAAATGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1023495244_1023495251 11 Left 1023495244 7:40788133-40788155 CCAGTAGTATTGAGGAGTCATTC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1023495251 7:40788167-40788189 GGGTATCGTGGAGACCAAATGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1023495242_1023495251 16 Left 1023495242 7:40788128-40788150 CCTGCCCAGTAGTATTGAGGAGT 0: 1
1: 0
2: 1
3: 16
4: 86
Right 1023495251 7:40788167-40788189 GGGTATCGTGGAGACCAAATGGG 0: 1
1: 0
2: 0
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023495251 Original CRISPR GGGTATCGTGGAGACCAAAT GGG Intronic
900957048 1:5892562-5892584 GGGTATAGTGGTGACAGAATGGG + Intronic
904532883 1:31180897-31180919 GAATATGGTGGAGACCACATAGG + Exonic
911165533 1:94721044-94721066 GGGCATTATGAAGACCAAATGGG + Intergenic
912534926 1:110360191-110360213 GGTTATCATGAAGACTAAATAGG + Intergenic
913140475 1:115936414-115936436 GGGTGTTGTGGAAATCAAATTGG - Intergenic
915515152 1:156408382-156408404 GGTTATCCTGAAGATCAAATGGG - Intronic
922562529 1:226579592-226579614 GGGGATCAGGGAGACCAACTTGG + Intronic
923618481 1:235557484-235557506 GGGTGTCTTGGAGACCACAGTGG - Intronic
1067966265 10:50916627-50916649 AGGTATCGAGGGAACCAAATCGG - Intergenic
1070501321 10:77075295-77075317 GGGCATCGTAGAGAACACATTGG + Intronic
1071889169 10:89983683-89983705 TGGTATCATGGAAACCAAAATGG + Intergenic
1077166338 11:1141117-1141139 GGGGATGGTGGAGACCACACGGG + Intergenic
1077866412 11:6225051-6225073 AGGAATCATGGAGACCAGATTGG - Intronic
1088186265 11:107175017-107175039 TGGAGTCGTGGGGACCAAATTGG + Intergenic
1090404699 11:126469645-126469667 GGTTCTCATGGAGACCAAAGGGG - Intronic
1093356138 12:18170313-18170335 GGGTATTGTGGAGAAGAATTGGG + Intronic
1108703271 13:52961922-52961944 AGGTATTGTGGAGAGAAAATGGG - Intergenic
1117231442 14:53723434-53723456 GGGTAAGGTGGAGAGGAAATGGG - Intergenic
1118931718 14:70247942-70247964 GGGTATAGAGGAGACAACATTGG + Intergenic
1118953448 14:70457183-70457205 GGGTATAGAGGAGACAACATTGG - Intronic
1119931790 14:78554449-78554471 AGGCTTCGTGGGGACCAAATTGG + Intronic
1124826609 15:33102610-33102632 GGGTATTATGGAGACCACAATGG + Intronic
1131485362 15:92815762-92815784 GGGCATGGTGGAGACTAATTAGG - Intergenic
1137547694 16:49415800-49415822 GGGAAGCATGGAGAGCAAATAGG - Intergenic
1152474971 17:80512118-80512140 GGGCTTCATGGAGACCAAAAGGG + Intergenic
1158896373 18:61917764-61917786 GGGTAAACTGGAGACAAAATGGG + Intergenic
1159443747 18:68513855-68513877 TGGTGTCATGGAGACCACATGGG - Intergenic
1161484235 19:4526068-4526090 GGGTTTGGGGAAGACCAAATGGG - Intronic
1165355918 19:35303960-35303982 GGGCATCGTGAAGACCAGAGAGG - Intronic
1165826970 19:38711103-38711125 GGGTTTTGTGGAGTCCGAATAGG - Intronic
1167037572 19:47003186-47003208 GGGAAGCGTGCAGCCCAAATGGG + Exonic
927066710 2:19479197-19479219 GGGTAGCAAGGAGACCAAAAGGG - Intergenic
928175810 2:29033668-29033690 GGGTATCGCTGAGACCTAGTTGG + Intronic
928219533 2:29391952-29391974 GGGTATTGTGAAGATCACATGGG + Intronic
928357491 2:30632711-30632733 GGGTTTTGTGAAGAGCAAATGGG - Intronic
939713024 2:145546885-145546907 GGGTGTCATTGAGATCAAATTGG + Intergenic
940887758 2:159004641-159004663 GTATATAGTGGAGAGCAAATTGG + Intronic
942150544 2:173072125-173072147 GGTTATTGTGAAGACTAAATGGG + Intergenic
1176105566 20:63384235-63384257 GGGTATCCCGGAGACCCAGTGGG - Intergenic
1177671012 21:24227443-24227465 GGGTATCACGAAAACCAAATGGG - Intergenic
1178097706 21:29233770-29233792 TGGTATCATAGAAACCAAATGGG - Intronic
954926618 3:54241545-54241567 GGGTTTTCTGGAGACCAATTTGG + Intronic
963999686 3:151754987-151755009 GGCTATCTTCGAGACCATATAGG + Intronic
964641312 3:158912884-158912906 GGGTAACAGGGAGAGCAAATGGG + Intergenic
974076007 4:57169131-57169153 TGGTATCCTGGGGAACAAATGGG + Intergenic
982677558 4:158393551-158393573 GGGTATAGTGGATACTATATTGG + Intronic
983816597 4:172136462-172136484 GGGGATCATTGAGACTAAATAGG - Intronic
987104808 5:14627773-14627795 GGGTGTGGTGGAGTACAAATGGG + Intergenic
999144141 5:149381561-149381583 TGGTCTGGTGGAGACCAAAGAGG + Intronic
1001972147 5:175965340-175965362 GAGTATTGTGAAGACCAAATGGG - Intronic
1002245293 5:177878437-177878459 GAGTATTGTGAAGACCAAATGGG + Intergenic
1006473716 6:34242305-34242327 GGGTGTCATGGAGATTAAATGGG - Intronic
1009545383 6:65013521-65013543 GGGGATCTTGGAAACCATATTGG - Intronic
1011344498 6:86354049-86354071 GGGTATAGTGGAGACCACACTGG - Intergenic
1023495251 7:40788167-40788189 GGGTATCGTGGAGACCAAATGGG + Intronic
1027193397 7:76011259-76011281 GGGTATAGAGGAAACAAAATTGG - Intronic
1027534184 7:79375589-79375611 GAGTTTCCTGAAGACCAAATGGG - Intronic
1028259366 7:88641787-88641809 GTGTCTCGTGGCTACCAAATTGG - Intergenic
1034123120 7:148645213-148645235 AGGTAGCGTGAAGACCAGATTGG - Intergenic
1037974967 8:23202532-23202554 GGGTATGATGAAGACCAAGTTGG + Intronic
1038295729 8:26289917-26289939 GAGTATCGTGGAGATGGAATGGG + Intergenic
1040138369 8:43881915-43881937 GGGTATCATTGAGACCAATGGGG - Intergenic
1041706066 8:60847460-60847482 GGTTATCGTGAAGATCAAAAGGG + Intronic
1044485157 8:92743890-92743912 GGGTATGGTGGTCACCAAAATGG + Intergenic
1048006998 8:130427525-130427547 GAGTATGGTGGAGATTAAATTGG - Intronic
1049268160 8:141680611-141680633 GGGTAACATGGAGCCCAAATCGG - Intergenic
1051145653 9:14024692-14024714 GCGAATCATAGAGACCAAATTGG - Intergenic
1051594552 9:18811295-18811317 GTGTAATGTGGAGACCACATGGG + Intronic
1059300695 9:113310493-113310515 GTGTGTGGTGGAGCCCAAATGGG - Intergenic
1059474325 9:114532091-114532113 GGGTATCCTGAAGAGCAAACCGG - Intergenic
1189599538 X:42608157-42608179 TAGTATAGTGGAGACCATATTGG - Intergenic
1198686100 X:139229492-139229514 TAGTGTCGTGGAGAACAAATGGG - Intergenic