ID: 1023501253

View in Genome Browser
Species Human (GRCh38)
Location 7:40852010-40852032
Sequence ACTTCTGATTTTACACATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023501253 Original CRISPR ACTTCTGATTTTACACATGC TGG Intronic
900664003 1:3801452-3801474 ACTCCCGTTTTTACAGATGCAGG + Intergenic
901614928 1:10531097-10531119 AATTCTGGTTTTCTACATGCAGG - Intronic
903429701 1:23285315-23285337 ACTTCTGCTCTTAGACATCCTGG + Intergenic
904885537 1:33735465-33735487 ATTTCTGATTTTACACCTAAGGG + Intronic
906041606 1:42792378-42792400 ACTCCTCATTTTACAGATGGGGG + Intronic
908284855 1:62585295-62585317 TCTTCTGATTTTCCACATACTGG - Intronic
910045276 1:82905921-82905943 CCTTCTCATTTTACAGATGAGGG - Intergenic
910433096 1:87178066-87178088 ACTTCTGATGCTGCAGATGCTGG + Intergenic
911743073 1:101408813-101408835 CCTTCTCATTTTATACATGAAGG - Intergenic
916355059 1:163895956-163895978 AGTTCTGATTTTTCATATGTTGG + Intergenic
920760029 1:208774668-208774690 ACGTCTGATTTTCTACATGGCGG - Intergenic
922287060 1:224179737-224179759 ACGTCTGTTTTTATAAATGCTGG + Intronic
922310266 1:224382034-224382056 AATTCTCATTTTACAAATGAGGG - Intergenic
1065301801 10:24329582-24329604 ACTTCTGATTTACTAAATGCAGG - Intronic
1068233760 10:54205153-54205175 ACTACTGATTCTACATATCCAGG - Intronic
1068741340 10:60475485-60475507 AAGTCTGATTTTACCCATGTGGG + Intronic
1068957632 10:62833587-62833609 ACTTATGATTGTACACATTATGG - Intronic
1069061423 10:63898552-63898574 CCTTCTCATTTTACATTTGCTGG - Intergenic
1069166128 10:65162198-65162220 ACTTCTGTTTTTACCCATGAGGG + Intergenic
1071917078 10:90305447-90305469 ACTTCTGATTTTCCTCTTTCTGG + Intergenic
1074033919 10:109718751-109718773 AACACTGATTTTACACATGTTGG - Intergenic
1074415634 10:113264629-113264651 AGTTCTGATTTGCCACATGAAGG + Intergenic
1075217435 10:120549039-120549061 ACTTCTGATTCTAGACATGAGGG + Intronic
1077678363 11:4217198-4217220 ACTCCTAATTCTTCACATGCTGG + Intergenic
1078205130 11:9222073-9222095 AATTATAATTTTACAAATGCAGG + Intronic
1079336398 11:19574320-19574342 ACCTCTCATTTTACAGATGAGGG - Intronic
1079532049 11:21466043-21466065 CCTTCTCATTTTATACATGAAGG + Intronic
1080686708 11:34522112-34522134 ACTTCTGATGTCACACCTGTTGG - Intergenic
1083470219 11:62879456-62879478 ACTTCTTATCTGGCACATGCAGG + Intronic
1086847585 11:91770847-91770869 ACTTCTGTTTTTAACCATGAGGG + Intergenic
1091874841 12:3925126-3925148 ACTTATGGTTTTCCACATTCTGG + Intergenic
1091974887 12:4816562-4816584 AATTCTGAGTTTACAGGTGCAGG - Intronic
1092517304 12:9227993-9228015 ACTTTTGCTTCCACACATGCAGG + Intergenic
1092921337 12:13234251-13234273 ACTTCTGATATGACACATTGTGG + Intergenic
1092954869 12:13540690-13540712 ATTTCTTATTTTGGACATGCAGG - Exonic
1093968309 12:25350478-25350500 ACTTCTAATTTTACAAATTTGGG + Intergenic
1095546276 12:43374063-43374085 GTTTCTCATTTTACACATGAGGG + Intronic
1095952398 12:47788871-47788893 ACTGATGGTTTTACACATGATGG - Intronic
1103200493 12:119084066-119084088 ACTTCCCATTTTACAGGTGCAGG + Intronic
1105863284 13:24436100-24436122 ACCCCTCATTTTACACATGAGGG + Intronic
1106733845 13:32569413-32569435 ACTTCTGAGTATACACCTGAAGG - Intergenic
1106749091 13:32739683-32739705 TCTTCTGATTTTAATCATGTTGG + Intronic
1106782835 13:33076870-33076892 GCTGCTGCTGTTACACATGCTGG - Intergenic
1107310188 13:39069206-39069228 TATTCTCATTTTACACATGAAGG + Intergenic
1108877386 13:55063080-55063102 AATTCTCATTTTACATATGAAGG + Intergenic
1109218921 13:59621085-59621107 ACTTCTGATTTTACGTATTTGGG - Intergenic
1110095721 13:71517711-71517733 ACTTCTGGTTGTGCTCATGCAGG - Intronic
1111720205 13:91934190-91934212 ACTTCTGATTTTTCCCATTTTGG - Intronic
1112588004 13:100736830-100736852 ACTTCTGATTCTATTCATGGGGG + Intergenic
1112712731 13:102149102-102149124 ATTTCTGTTTTGACCCATGCAGG - Intronic
1112897378 13:104316481-104316503 ACATCTGAATTTATACATGAAGG + Intergenic
1112902469 13:104374719-104374741 ACTTCTGATTTCAAGCATGTTGG - Intergenic
1117447420 14:55817995-55818017 ATTTCTTATTTTACACATTAAGG - Intergenic
1120409699 14:84137543-84137565 ACTTCTAATTTTACACATATGGG + Intergenic
1120745942 14:88151997-88152019 ACTTCTGAGTTCACTCATGAAGG + Intergenic
1120931311 14:89851348-89851370 ACTTGTGATCTTATACATTCTGG - Intronic
1121267328 14:92612768-92612790 ACTTATGATTTTACAAATCTGGG + Intronic
1121518692 14:94570803-94570825 AATTCTGGTTTTGAACATGCTGG - Intronic
1121829917 14:97042448-97042470 ACTTCTGGTTCTACTCATGATGG - Intergenic
1125156816 15:36596880-36596902 ATTACTGTTTTGACACATGCAGG - Intronic
1125380940 15:39086021-39086043 ATTTCTAATTTTAGACATGTGGG - Intergenic
1127045351 15:55019600-55019622 ACTACCGATTTTACAGATGTAGG + Intergenic
1127076929 15:55335974-55335996 ACTTCTGAATTATCAAATGCTGG - Intronic
1128611437 15:69076741-69076763 ACTTCTGATTTCACCCATCTGGG - Intergenic
1128616755 15:69116216-69116238 AGTTCTGGCTTCACACATGCTGG + Intergenic
1128643568 15:69358569-69358591 TCTTCTCATGTTACACATGAAGG - Intronic
1130968284 15:88713102-88713124 AATTCTGATTTTTCCCATGATGG - Intergenic
1133763045 16:8815123-8815145 TCTTCTCAGTTTACTCATGCTGG + Intronic
1134294437 16:12932986-12933008 ACTTATGATTTTGCAAATGAGGG + Intronic
1135050988 16:19192903-19192925 AATTCTGATTTCCCACATCCTGG + Intronic
1135232352 16:20720716-20720738 TCTTCTTATTTTACAAATGTAGG - Intronic
1138235560 16:55379660-55379682 ACTTATGATTCCACAAATGCAGG + Intergenic
1138555542 16:57769334-57769356 ACTTCATATTTCAAACATGCAGG - Intronic
1141606334 16:85155931-85155953 ACTTGTGATTTTAGAACTGCAGG + Intergenic
1143262881 17:5613442-5613464 ACTTCTGATTGTTCACATTAGGG + Intronic
1145407994 17:22625514-22625536 CCTACTGATTTTCCACCTGCTGG + Intergenic
1146499528 17:33352479-33352501 GCTTCTCATTTTACAAAAGCAGG - Intronic
1148637869 17:49162988-49163010 ACTTCTGATTTTTGTCATTCTGG + Intronic
1150117453 17:62566035-62566057 ACTTTTGATTTGAAACATTCAGG + Intronic
1150811536 17:68360800-68360822 ATGTCTGATTTCAAACATGCTGG - Intronic
1151345365 17:73498092-73498114 AGTTCTGCTTCTACACATGGGGG + Intronic
1156243823 18:35278329-35278351 ACTTCTGGTATTACAAAAGCAGG - Intronic
1157177322 18:45463536-45463558 TCTTCACATTTGACACATGCAGG + Intronic
1158813601 18:61067632-61067654 ACTTTTGTTTTGAGACATGCAGG - Intergenic
1159360348 18:67393293-67393315 ACTTCTGATTTTATTCATTTGGG + Intergenic
1163895869 19:20058496-20058518 ACTTCTGATTCTACATCTGAAGG - Intergenic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
1166716675 19:44972996-44973018 CCTTCTGACTTAGCACATGCTGG - Intronic
927234811 2:20862016-20862038 AAATCTGATTTTACACATAATGG + Intergenic
929495353 2:42436816-42436838 AAATCTGATTTTACACACGCTGG + Intergenic
932299842 2:70658747-70658769 CTTACTCATTTTACACATGCAGG - Exonic
935945518 2:108282779-108282801 CCTTCTGATTTTAGACATTCTGG + Intergenic
939687681 2:145219770-145219792 ACTTCTAATTTTACTCTGGCAGG + Intergenic
940264513 2:151822136-151822158 ACTTCTGATGATTCACGTGCAGG - Intronic
944098988 2:196001728-196001750 ACTTATGACTTTACAGCTGCAGG - Exonic
946559557 2:220897572-220897594 ACTTCCCATTTGAGACATGCTGG + Intergenic
946962548 2:225000249-225000271 ATTACTGGTTTTACACATGATGG + Intronic
1169466495 20:5845616-5845638 TTTTCTTATGTTACACATGCTGG - Intronic
1169610344 20:7372777-7372799 ATTTCAGATTCTACACATGAAGG + Intergenic
1169719022 20:8651955-8651977 ACTTCTGATTTTACCTTTTCTGG + Intronic
1170146603 20:13181788-13181810 AGATCTGATTTTACAGATGAAGG - Intergenic
1172539596 20:35700673-35700695 ACATCTGATTTTCCACTTACTGG - Intronic
1174465672 20:50715365-50715387 CCTTCTGATTTTAAAGATGGAGG + Intergenic
1174641047 20:52044531-52044553 ACATATGATTTTAAACATGTGGG + Intergenic
1175488788 20:59364791-59364813 GCTGCTCATTTTACACATGAGGG + Intergenic
1181406720 22:22690203-22690225 ACTTCTCACTGGACACATGCAGG - Intergenic
1181414695 22:22750853-22750875 ACTTCTCATTGGACACATGCAGG - Intronic
1182082353 22:27538432-27538454 ATTTCTGATATTACAAAGGCTGG - Intergenic
1182242242 22:28925309-28925331 AAATCTGGTTTTACACATGCTGG - Intronic
949569064 3:5274184-5274206 ATTGCTGATTTTACAGATGGAGG + Intergenic
953268025 3:41412032-41412054 ACATCTGATTTTCTACATACAGG - Intronic
955554730 3:60124827-60124849 ACTTCTCATTTTACAAATTGGGG - Intronic
956013305 3:64854600-64854622 ACTTATGAGAATACACATGCAGG - Intergenic
958624823 3:96610414-96610436 TCTTCTCATTTTACTTATGCAGG + Intergenic
959784098 3:110272603-110272625 ACTTCAGATTTTATCCATACAGG - Intergenic
960572485 3:119198935-119198957 AATTCTGATTTCACATATCCAGG - Intronic
960628546 3:119704417-119704439 AGTTCTGATTTTCCCCATCCAGG - Intronic
961032658 3:123620075-123620097 ACTTCTGAATTTATCCTTGCAGG + Intronic
961939679 3:130624212-130624234 TCCTCTGATTATAAACATGCTGG - Intronic
962809897 3:138950791-138950813 AATTCAGATTTTGCACATGTTGG + Exonic
965024905 3:163289634-163289656 ACTTCTGAGTTTAGTCATTCTGG - Intergenic
965815865 3:172636081-172636103 ACTTTTGTTTTTACAGATACAGG - Exonic
970555030 4:17222922-17222944 AATTCTGGTTTTAAAAATGCAGG + Intergenic
970625605 4:17875598-17875620 ACTTCTGATATGAGACATTCTGG + Intronic
974473856 4:62354891-62354913 ACATCTGGATGTACACATGCTGG + Intergenic
974750784 4:66138116-66138138 GCTTCTGATGTTCCAAATGCTGG - Intergenic
975473723 4:74797928-74797950 ACTTCTGATTTTAAAAAATCTGG + Intergenic
976310848 4:83611455-83611477 ACTTCTGATTTTATATATTTGGG + Intergenic
978115231 4:105011952-105011974 AATGCTGTTTTTACACATTCAGG + Intergenic
978536104 4:109765495-109765517 ACTTCACATTTTACAGATGAGGG + Intronic
978636425 4:110813031-110813053 ACTTATGATTTCACAGTTGCCGG + Intergenic
979315912 4:119263150-119263172 ACTTCTGATTCTACCCATGAAGG + Intronic
979355038 4:119693196-119693218 ACTTCTCTCTTTAGACATGCAGG - Intergenic
981669214 4:147267363-147267385 GCTTCTGATTTTTCATATCCAGG + Intergenic
981670511 4:147280672-147280694 ACGTCTAATTTTACACATCAAGG + Intergenic
981717660 4:147767431-147767453 AATTCTGATACTAGACATGCAGG - Intronic
982654754 4:158133943-158133965 ACAGCTGATTTTACATCTGCAGG - Intronic
983358038 4:166690071-166690093 ACTTCAGTCTTTCCACATGCTGG + Intergenic
984071053 4:175113102-175113124 ATTTCTGATTTTACTCATTTGGG - Intergenic
986288176 5:6376487-6376509 ATCTCTGATTTCACACATGAAGG - Intronic
987073097 5:14356747-14356769 AATTGTGGTTTCACACATGCAGG + Intronic
988024050 5:25661127-25661149 CCTTCTGATTTTACAAATTTTGG + Intergenic
989105743 5:37861601-37861623 GCCTCTGTTTTTACACTTGCAGG - Intergenic
990653676 5:57930814-57930836 GCTTCTGATTTTACCCTTCCAGG + Intergenic
993766256 5:91862435-91862457 ACTTCTGATTATACTGATCCTGG + Intergenic
994525188 5:100898261-100898283 ACTTGTGATGTTACCCAGGCTGG - Intronic
997084144 5:130776528-130776550 ACTTCTGATGTGTCCCATGCAGG + Intergenic
997697088 5:135870155-135870177 CAATCTGATTTTACACATGCTGG - Intronic
997889352 5:137661266-137661288 ACTCCTTTTTTTACACATGTAGG - Intronic
998359735 5:141574297-141574319 ACTTCTCATGTTACAAATGGAGG + Intronic
999652024 5:153777133-153777155 ACTTCTGATTTTGCAGATCCAGG + Intronic
1004718308 6:18240758-18240780 TCTTCTGATTTTGCCCAGGCTGG - Intronic
1007714449 6:43847512-43847534 ATTTCTGATGGTACATATGCTGG - Intergenic
1011335582 6:86256106-86256128 AGTTCAGAATTTACACATGATGG + Intergenic
1011736054 6:90311655-90311677 ACTTATGATTTAACACAGGCCGG + Intergenic
1012057746 6:94436161-94436183 GCCTCTGATGTTACTCATGCTGG - Intergenic
1012201933 6:96417207-96417229 AATTCAGATGTTACACGTGCAGG - Intergenic
1012394931 6:98785431-98785453 ATTTCTGATTTGACAAATGTTGG + Intergenic
1012550650 6:100462205-100462227 ACTTCTGATTTGACCCCTGGAGG - Intronic
1015829992 6:137358425-137358447 GCTTCTGATATCACACCTGCTGG + Intergenic
1017454637 6:154589978-154590000 ACTTCTGATTATACATATATTGG - Intergenic
1017833791 6:158157605-158157627 TCTTCTCATTTTACACATAAAGG + Intronic
1019054717 6:169214774-169214796 ACTTTTCTTTTTACACATGTAGG + Intergenic
1020342736 7:7130316-7130338 ACTCCTGATTTCACACATTTAGG + Intergenic
1022821018 7:33961103-33961125 ACCTGCGATTTTGCACATGCTGG - Intronic
1023501253 7:40852010-40852032 ACTTCTGATTTTACACATGCTGG + Intronic
1024186776 7:46957353-46957375 ACTTCTGTTATCACACATGCAGG - Intergenic
1024973786 7:55094635-55094657 ACTTCTCCTTTCACATATGCTGG + Intronic
1026368904 7:69678386-69678408 AATTCTGCTTTTACACACGCTGG - Intronic
1029110024 7:98209023-98209045 ACTTCTGAATTTTCAGATGATGG - Exonic
1029799073 7:102926696-102926718 ACTTCTGACTCTTCATATGCAGG + Intronic
1030777718 7:113555455-113555477 AGTTCTGATTTTAGTCATTCTGG - Intergenic
1030987340 7:116257854-116257876 TCTTTTCATTTTACACATGAGGG - Exonic
1031951945 7:127901713-127901735 ACTTCTCAGTTTACATATGCTGG + Intronic
1032748914 7:134816395-134816417 ACTTATTAATTTTCACATGCTGG + Intronic
1033781018 7:144668709-144668731 ACTTCTGAGTTAAGACCTGCAGG - Intronic
1034256552 7:149727871-149727893 ACTTCTGAATGTCCACAGGCTGG - Intronic
1037348160 8:17922426-17922448 CCTCCTGATTTTACATATGAGGG - Intergenic
1039930004 8:41977642-41977664 AGTTCTCATTTTACAGATGAAGG - Intronic
1041246965 8:55897411-55897433 ACCTCTGACTTTGCACATGGTGG + Intronic
1041599152 8:59695124-59695146 ACTTCTGATTATATACCTGAGGG + Intergenic
1044240241 8:89879959-89879981 TCTTTTGATTTTAGACATTCTGG - Intergenic
1045895203 8:107208127-107208149 AGTTCTCATTTCACAAATGCAGG - Intergenic
1046045351 8:108957332-108957354 ACTGCTGCTTTTGCACATACTGG + Intergenic
1046542215 8:115600283-115600305 TCTACTGATTTCACACATGATGG + Intronic
1047063926 8:121259432-121259454 CATTCTGAATTTTCACATGCAGG + Intergenic
1047127519 8:121978713-121978735 ACTTCAGATTTTCCACTTGTAGG - Intergenic
1048188913 8:132270513-132270535 ACTCCTTATTTTACATATGAAGG - Intronic
1048496672 8:134941421-134941443 ACTCCTTATTTTACACTTGAAGG - Intergenic
1051525726 9:18041879-18041901 ACATCTGATTTTAGAAATGTTGG + Intergenic
1052573588 9:30262785-30262807 ATTTCTGATTTTATACATTTAGG + Intergenic
1054883488 9:70170748-70170770 ACTTGTGATTCTACACACACAGG + Intronic
1056839176 9:89984457-89984479 ACTCCTAATATTTCACATGCTGG + Intergenic
1058542942 9:106030829-106030851 AATTCTCATTTTAAAGATGCAGG + Intergenic
1059747094 9:117213763-117213785 AATTCTAATTTTTCACATCCTGG - Intronic
1062075055 9:134583393-134583415 ACTTCTGAATTTTCAGATGACGG + Intergenic
1188731553 X:33652269-33652291 ACTTCAGATTTAACATATTCAGG - Intergenic
1192051930 X:67732422-67732444 ACTTCTTATTCTTCACATGAGGG + Intergenic
1192865733 X:75130221-75130243 AATTCTGATTTTAAAAATACAGG + Intronic
1194796385 X:98216104-98216126 ACTTCTGCTTCTAAACAAGCAGG - Intergenic
1196679739 X:118458662-118458684 ACTTCTGAATTTACACCTAGAGG + Intergenic
1197352868 X:125399609-125399631 ACTTCTTATAACACACATGCTGG - Intergenic
1200780989 Y:7215496-7215518 ATTTATGATTTTGCAAATGCTGG + Intergenic
1200832573 Y:7701739-7701761 ACCTCTGATGTTACAAATTCTGG + Intergenic
1201324450 Y:12740593-12740615 AATTCTGATTTAACACATCTGGG - Intronic
1202603289 Y:26616141-26616163 ACCCCTCATTTTACACATGAGGG + Intergenic