ID: 1023502291

View in Genome Browser
Species Human (GRCh38)
Location 7:40863747-40863769
Sequence AAGAATTCCATCAATTAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023502291_1023502295 -10 Left 1023502291 7:40863747-40863769 CCCTTCTAATTGATGGAATTCTT No data
Right 1023502295 7:40863760-40863782 TGGAATTCTTGAGGTACAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023502291 Original CRISPR AAGAATTCCATCAATTAGAA GGG (reversed) Intergenic
No off target data available for this crispr