ID: 1023506917

View in Genome Browser
Species Human (GRCh38)
Location 7:40909418-40909440
Sequence TTGGCCCACAGCCCATGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023506917_1023506918 -6 Left 1023506917 7:40909418-40909440 CCTGCTCATGGGCTGTGGGCCAA No data
Right 1023506918 7:40909435-40909457 GGCCAATGTTTAGTTCCTGAAGG No data
1023506917_1023506921 22 Left 1023506917 7:40909418-40909440 CCTGCTCATGGGCTGTGGGCCAA No data
Right 1023506921 7:40909463-40909485 TATTTTCTGACAGTCAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023506917 Original CRISPR TTGGCCCACAGCCCATGAGC AGG (reversed) Intergenic
No off target data available for this crispr