ID: 1023506918

View in Genome Browser
Species Human (GRCh38)
Location 7:40909435-40909457
Sequence GGCCAATGTTTAGTTCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023506912_1023506918 11 Left 1023506912 7:40909401-40909423 CCGGGGTTCGCTAGGCTCCTGCT No data
Right 1023506918 7:40909435-40909457 GGCCAATGTTTAGTTCCTGAAGG No data
1023506910_1023506918 13 Left 1023506910 7:40909399-40909421 CCCCGGGGTTCGCTAGGCTCCTG No data
Right 1023506918 7:40909435-40909457 GGCCAATGTTTAGTTCCTGAAGG No data
1023506911_1023506918 12 Left 1023506911 7:40909400-40909422 CCCGGGGTTCGCTAGGCTCCTGC No data
Right 1023506918 7:40909435-40909457 GGCCAATGTTTAGTTCCTGAAGG No data
1023506917_1023506918 -6 Left 1023506917 7:40909418-40909440 CCTGCTCATGGGCTGTGGGCCAA No data
Right 1023506918 7:40909435-40909457 GGCCAATGTTTAGTTCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023506918 Original CRISPR GGCCAATGTTTAGTTCCTGA AGG Intergenic
No off target data available for this crispr