ID: 1023506919

View in Genome Browser
Species Human (GRCh38)
Location 7:40909437-40909459
Sequence CACCTTCAGGAACTAAACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023506919_1023506921 3 Left 1023506919 7:40909437-40909459 CCAATGTTTAGTTCCTGAAGGTG No data
Right 1023506921 7:40909463-40909485 TATTTTCTGACAGTCAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023506919 Original CRISPR CACCTTCAGGAACTAAACAT TGG (reversed) Intergenic
No off target data available for this crispr