ID: 1023506920

View in Genome Browser
Species Human (GRCh38)
Location 7:40909450-40909472
Sequence TCAGAAAATACAACACCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023506920_1023506922 25 Left 1023506920 7:40909450-40909472 CCTGAAGGTGTTGTATTTTCTGA No data
Right 1023506922 7:40909498-40909520 GTGAAACATGAATACAACTGAGG No data
1023506920_1023506921 -10 Left 1023506920 7:40909450-40909472 CCTGAAGGTGTTGTATTTTCTGA No data
Right 1023506921 7:40909463-40909485 TATTTTCTGACAGTCAAAATTGG No data
1023506920_1023506923 30 Left 1023506920 7:40909450-40909472 CCTGAAGGTGTTGTATTTTCTGA No data
Right 1023506923 7:40909503-40909525 ACATGAATACAACTGAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023506920 Original CRISPR TCAGAAAATACAACACCTTC AGG (reversed) Intergenic
No off target data available for this crispr