ID: 1023515663

View in Genome Browser
Species Human (GRCh38)
Location 7:40998691-40998713
Sequence GGATGCTCAAAATATCCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023515663_1023515668 20 Left 1023515663 7:40998691-40998713 CCCAAGGGATATTTTGAGCATCC No data
Right 1023515668 7:40998734-40998756 TACAATGAGCTTCTCCTCATTGG No data
1023515663_1023515669 23 Left 1023515663 7:40998691-40998713 CCCAAGGGATATTTTGAGCATCC No data
Right 1023515669 7:40998737-40998759 AATGAGCTTCTCCTCATTGGTGG No data
1023515663_1023515666 -9 Left 1023515663 7:40998691-40998713 CCCAAGGGATATTTTGAGCATCC No data
Right 1023515666 7:40998705-40998727 TGAGCATCCAGAATTAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023515663 Original CRISPR GGATGCTCAAAATATCCCTT GGG (reversed) Intergenic
No off target data available for this crispr