ID: 1023516302

View in Genome Browser
Species Human (GRCh38)
Location 7:41005358-41005380
Sequence CATGGGTGGGGGGATGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023516302_1023516313 -9 Left 1023516302 7:41005358-41005380 CCTGCCCCATCCCCCCACCCATG No data
Right 1023516313 7:41005372-41005394 CCACCCATGAGGGATAAAAGAGG No data
1023516302_1023516317 20 Left 1023516302 7:41005358-41005380 CCTGCCCCATCCCCCCACCCATG No data
Right 1023516317 7:41005401-41005423 CATATAAAGTCTTCTCCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023516302 Original CRISPR CATGGGTGGGGGGATGGGGC AGG (reversed) Intergenic
No off target data available for this crispr