ID: 1023516313

View in Genome Browser
Species Human (GRCh38)
Location 7:41005372-41005394
Sequence CCACCCATGAGGGATAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023516302_1023516313 -9 Left 1023516302 7:41005358-41005380 CCTGCCCCATCCCCCCACCCATG No data
Right 1023516313 7:41005372-41005394 CCACCCATGAGGGATAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023516313 Original CRISPR CCACCCATGAGGGATAAAAG AGG Intergenic
No off target data available for this crispr