ID: 1023516317

View in Genome Browser
Species Human (GRCh38)
Location 7:41005401-41005423
Sequence CATATAAAGTCTTCTCCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023516315_1023516317 2 Left 1023516315 7:41005376-41005398 CCATGAGGGATAAAAGAGGTGTC No data
Right 1023516317 7:41005401-41005423 CATATAAAGTCTTCTCCATCAGG No data
1023516310_1023516317 8 Left 1023516310 7:41005370-41005392 CCCCACCCATGAGGGATAAAAGA No data
Right 1023516317 7:41005401-41005423 CATATAAAGTCTTCTCCATCAGG No data
1023516302_1023516317 20 Left 1023516302 7:41005358-41005380 CCTGCCCCATCCCCCCACCCATG No data
Right 1023516317 7:41005401-41005423 CATATAAAGTCTTCTCCATCAGG No data
1023516306_1023516317 15 Left 1023516306 7:41005363-41005385 CCCATCCCCCCACCCATGAGGGA No data
Right 1023516317 7:41005401-41005423 CATATAAAGTCTTCTCCATCAGG No data
1023516304_1023516317 16 Left 1023516304 7:41005362-41005384 CCCCATCCCCCCACCCATGAGGG No data
Right 1023516317 7:41005401-41005423 CATATAAAGTCTTCTCCATCAGG No data
1023516307_1023516317 14 Left 1023516307 7:41005364-41005386 CCATCCCCCCACCCATGAGGGAT No data
Right 1023516317 7:41005401-41005423 CATATAAAGTCTTCTCCATCAGG No data
1023516309_1023516317 9 Left 1023516309 7:41005369-41005391 CCCCCACCCATGAGGGATAAAAG No data
Right 1023516317 7:41005401-41005423 CATATAAAGTCTTCTCCATCAGG No data
1023516314_1023516317 3 Left 1023516314 7:41005375-41005397 CCCATGAGGGATAAAAGAGGTGT No data
Right 1023516317 7:41005401-41005423 CATATAAAGTCTTCTCCATCAGG No data
1023516312_1023516317 6 Left 1023516312 7:41005372-41005394 CCACCCATGAGGGATAAAAGAGG No data
Right 1023516317 7:41005401-41005423 CATATAAAGTCTTCTCCATCAGG No data
1023516311_1023516317 7 Left 1023516311 7:41005371-41005393 CCCACCCATGAGGGATAAAAGAG No data
Right 1023516317 7:41005401-41005423 CATATAAAGTCTTCTCCATCAGG No data
1023516308_1023516317 10 Left 1023516308 7:41005368-41005390 CCCCCCACCCATGAGGGATAAAA No data
Right 1023516317 7:41005401-41005423 CATATAAAGTCTTCTCCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023516317 Original CRISPR CATATAAAGTCTTCTCCATC AGG Intergenic
No off target data available for this crispr