ID: 1023517403

View in Genome Browser
Species Human (GRCh38)
Location 7:41015621-41015643
Sequence GATGCCCGTTACCATTTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023517403_1023517406 5 Left 1023517403 7:41015621-41015643 CCCTTCAAATGGTAACGGGCATC No data
Right 1023517406 7:41015649-41015671 ATTTGTAGTCAACTGCATTGAGG No data
1023517403_1023517408 27 Left 1023517403 7:41015621-41015643 CCCTTCAAATGGTAACGGGCATC No data
Right 1023517408 7:41015671-41015693 GTAATGAAACTTTCTATAGGAGG No data
1023517403_1023517407 24 Left 1023517403 7:41015621-41015643 CCCTTCAAATGGTAACGGGCATC No data
Right 1023517407 7:41015668-41015690 GAGGTAATGAAACTTTCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023517403 Original CRISPR GATGCCCGTTACCATTTGAA GGG (reversed) Intergenic
No off target data available for this crispr