ID: 1023519785

View in Genome Browser
Species Human (GRCh38)
Location 7:41038810-41038832
Sequence GTGATATTGACCTCGAAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023519782_1023519785 21 Left 1023519782 7:41038766-41038788 CCATCTCTCTTCACTTCAGTTTC No data
Right 1023519785 7:41038810-41038832 GTGATATTGACCTCGAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023519785 Original CRISPR GTGATATTGACCTCGAAATG GGG Intergenic