ID: 1023525309

View in Genome Browser
Species Human (GRCh38)
Location 7:41096392-41096414
Sequence ATTCAAAAGAGTGTCTATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023525309_1023525314 24 Left 1023525309 7:41096392-41096414 CCTACATAGACACTCTTTTGAAT No data
Right 1023525314 7:41096439-41096461 TGGAGTTAGTAGGTACATTTAGG No data
1023525309_1023525311 4 Left 1023525309 7:41096392-41096414 CCTACATAGACACTCTTTTGAAT No data
Right 1023525311 7:41096419-41096441 TTCTTTGGAAGAATGATGCCTGG No data
1023525309_1023525315 25 Left 1023525309 7:41096392-41096414 CCTACATAGACACTCTTTTGAAT No data
Right 1023525315 7:41096440-41096462 GGAGTTAGTAGGTACATTTAGGG No data
1023525309_1023525316 28 Left 1023525309 7:41096392-41096414 CCTACATAGACACTCTTTTGAAT No data
Right 1023525316 7:41096443-41096465 GTTAGTAGGTACATTTAGGGAGG No data
1023525309_1023525317 29 Left 1023525309 7:41096392-41096414 CCTACATAGACACTCTTTTGAAT No data
Right 1023525317 7:41096444-41096466 TTAGTAGGTACATTTAGGGAGGG No data
1023525309_1023525312 14 Left 1023525309 7:41096392-41096414 CCTACATAGACACTCTTTTGAAT No data
Right 1023525312 7:41096429-41096451 GAATGATGCCTGGAGTTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023525309 Original CRISPR ATTCAAAAGAGTGTCTATGT AGG (reversed) Intergenic
No off target data available for this crispr