ID: 1023529905

View in Genome Browser
Species Human (GRCh38)
Location 7:41141859-41141881
Sequence CAGTGTCCCAAAAGAGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023529905_1023529907 4 Left 1023529905 7:41141859-41141881 CCATATTCTCTTTTGGGACACTG No data
Right 1023529907 7:41141886-41141908 TAGGTGAAATTCTAGATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023529905 Original CRISPR CAGTGTCCCAAAAGAGAATA TGG (reversed) Intergenic
No off target data available for this crispr