ID: 1023531551

View in Genome Browser
Species Human (GRCh38)
Location 7:41161795-41161817
Sequence GAATTCTTAATGTCTTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023531545_1023531551 23 Left 1023531545 7:41161749-41161771 CCCACTGCAGACCTACTAAGTCA No data
Right 1023531551 7:41161795-41161817 GAATTCTTAATGTCTTTAGGAGG No data
1023531544_1023531551 24 Left 1023531544 7:41161748-41161770 CCCCACTGCAGACCTACTAAGTC No data
Right 1023531551 7:41161795-41161817 GAATTCTTAATGTCTTTAGGAGG No data
1023531547_1023531551 12 Left 1023531547 7:41161760-41161782 CCTACTAAGTCAGAATTGCTATT No data
Right 1023531551 7:41161795-41161817 GAATTCTTAATGTCTTTAGGAGG No data
1023531546_1023531551 22 Left 1023531546 7:41161750-41161772 CCACTGCAGACCTACTAAGTCAG No data
Right 1023531551 7:41161795-41161817 GAATTCTTAATGTCTTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023531551 Original CRISPR GAATTCTTAATGTCTTTAGG AGG Intergenic
No off target data available for this crispr