ID: 1023540408

View in Genome Browser
Species Human (GRCh38)
Location 7:41258736-41258758
Sequence TCTCCCTCCCCACTAACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023540406_1023540408 9 Left 1023540406 7:41258704-41258726 CCTAAATAGTTTCTCTGCTTTGC No data
Right 1023540408 7:41258736-41258758 TCTCCCTCCCCACTAACCCCTGG No data
1023540405_1023540408 10 Left 1023540405 7:41258703-41258725 CCCTAAATAGTTTCTCTGCTTTG No data
Right 1023540408 7:41258736-41258758 TCTCCCTCCCCACTAACCCCTGG No data
1023540404_1023540408 26 Left 1023540404 7:41258687-41258709 CCAAATAGTATCACTGCCCTAAA No data
Right 1023540408 7:41258736-41258758 TCTCCCTCCCCACTAACCCCTGG No data
1023540403_1023540408 30 Left 1023540403 7:41258683-41258705 CCTACCAAATAGTATCACTGCCC No data
Right 1023540408 7:41258736-41258758 TCTCCCTCCCCACTAACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023540408 Original CRISPR TCTCCCTCCCCACTAACCCC TGG Intergenic
No off target data available for this crispr