ID: 1023542036

View in Genome Browser
Species Human (GRCh38)
Location 7:41275891-41275913
Sequence GCCTAGAGACTGTACTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023542036_1023542040 -8 Left 1023542036 7:41275891-41275913 CCCTCCCAGTACAGTCTCTAGGC No data
Right 1023542040 7:41275906-41275928 CTCTAGGCCAGTAAGACCCTAGG No data
1023542036_1023542047 26 Left 1023542036 7:41275891-41275913 CCCTCCCAGTACAGTCTCTAGGC No data
Right 1023542047 7:41275940-41275962 AGGCGTAGAGGAAGCTGTGTTGG No data
1023542036_1023542045 14 Left 1023542036 7:41275891-41275913 CCCTCCCAGTACAGTCTCTAGGC No data
Right 1023542045 7:41275928-41275950 GAGAAGAGCCACAGGCGTAGAGG No data
1023542036_1023542042 6 Left 1023542036 7:41275891-41275913 CCCTCCCAGTACAGTCTCTAGGC No data
Right 1023542042 7:41275920-41275942 GACCCTAGGAGAAGAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023542036 Original CRISPR GCCTAGAGACTGTACTGGGA GGG (reversed) Intergenic
No off target data available for this crispr