ID: 1023542040

View in Genome Browser
Species Human (GRCh38)
Location 7:41275906-41275928
Sequence CTCTAGGCCAGTAAGACCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023542036_1023542040 -8 Left 1023542036 7:41275891-41275913 CCCTCCCAGTACAGTCTCTAGGC No data
Right 1023542040 7:41275906-41275928 CTCTAGGCCAGTAAGACCCTAGG No data
1023542034_1023542040 -7 Left 1023542034 7:41275890-41275912 CCCCTCCCAGTACAGTCTCTAGG No data
Right 1023542040 7:41275906-41275928 CTCTAGGCCAGTAAGACCCTAGG No data
1023542037_1023542040 -9 Left 1023542037 7:41275892-41275914 CCTCCCAGTACAGTCTCTAGGCC No data
Right 1023542040 7:41275906-41275928 CTCTAGGCCAGTAAGACCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023542040 Original CRISPR CTCTAGGCCAGTAAGACCCT AGG Intergenic
No off target data available for this crispr