ID: 1023542042

View in Genome Browser
Species Human (GRCh38)
Location 7:41275920-41275942
Sequence GACCCTAGGAGAAGAGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023542034_1023542042 7 Left 1023542034 7:41275890-41275912 CCCCTCCCAGTACAGTCTCTAGG No data
Right 1023542042 7:41275920-41275942 GACCCTAGGAGAAGAGCCACAGG No data
1023542037_1023542042 5 Left 1023542037 7:41275892-41275914 CCTCCCAGTACAGTCTCTAGGCC No data
Right 1023542042 7:41275920-41275942 GACCCTAGGAGAAGAGCCACAGG No data
1023542039_1023542042 1 Left 1023542039 7:41275896-41275918 CCAGTACAGTCTCTAGGCCAGTA No data
Right 1023542042 7:41275920-41275942 GACCCTAGGAGAAGAGCCACAGG No data
1023542036_1023542042 6 Left 1023542036 7:41275891-41275913 CCCTCCCAGTACAGTCTCTAGGC No data
Right 1023542042 7:41275920-41275942 GACCCTAGGAGAAGAGCCACAGG No data
1023542038_1023542042 2 Left 1023542038 7:41275895-41275917 CCCAGTACAGTCTCTAGGCCAGT No data
Right 1023542042 7:41275920-41275942 GACCCTAGGAGAAGAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023542042 Original CRISPR GACCCTAGGAGAAGAGCCAC AGG Intergenic
No off target data available for this crispr