ID: 1023542047

View in Genome Browser
Species Human (GRCh38)
Location 7:41275940-41275962
Sequence AGGCGTAGAGGAAGCTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023542039_1023542047 21 Left 1023542039 7:41275896-41275918 CCAGTACAGTCTCTAGGCCAGTA No data
Right 1023542047 7:41275940-41275962 AGGCGTAGAGGAAGCTGTGTTGG No data
1023542044_1023542047 -6 Left 1023542044 7:41275923-41275945 CCTAGGAGAAGAGCCACAGGCGT No data
Right 1023542047 7:41275940-41275962 AGGCGTAGAGGAAGCTGTGTTGG No data
1023542036_1023542047 26 Left 1023542036 7:41275891-41275913 CCCTCCCAGTACAGTCTCTAGGC No data
Right 1023542047 7:41275940-41275962 AGGCGTAGAGGAAGCTGTGTTGG No data
1023542041_1023542047 4 Left 1023542041 7:41275913-41275935 CCAGTAAGACCCTAGGAGAAGAG No data
Right 1023542047 7:41275940-41275962 AGGCGTAGAGGAAGCTGTGTTGG No data
1023542034_1023542047 27 Left 1023542034 7:41275890-41275912 CCCCTCCCAGTACAGTCTCTAGG No data
Right 1023542047 7:41275940-41275962 AGGCGTAGAGGAAGCTGTGTTGG No data
1023542038_1023542047 22 Left 1023542038 7:41275895-41275917 CCCAGTACAGTCTCTAGGCCAGT No data
Right 1023542047 7:41275940-41275962 AGGCGTAGAGGAAGCTGTGTTGG No data
1023542043_1023542047 -5 Left 1023542043 7:41275922-41275944 CCCTAGGAGAAGAGCCACAGGCG No data
Right 1023542047 7:41275940-41275962 AGGCGTAGAGGAAGCTGTGTTGG No data
1023542037_1023542047 25 Left 1023542037 7:41275892-41275914 CCTCCCAGTACAGTCTCTAGGCC No data
Right 1023542047 7:41275940-41275962 AGGCGTAGAGGAAGCTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023542047 Original CRISPR AGGCGTAGAGGAAGCTGTGT TGG Intergenic
No off target data available for this crispr