ID: 1023548673

View in Genome Browser
Species Human (GRCh38)
Location 7:41345514-41345536
Sequence TGGGCGAGTGCTGCATTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023548668_1023548673 2 Left 1023548668 7:41345489-41345511 CCATGTTTCCATTGTCTAATGCT No data
Right 1023548673 7:41345514-41345536 TGGGCGAGTGCTGCATTTTCAGG No data
1023548672_1023548673 -6 Left 1023548672 7:41345497-41345519 CCATTGTCTAATGCTGGTGGGCG No data
Right 1023548673 7:41345514-41345536 TGGGCGAGTGCTGCATTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023548673 Original CRISPR TGGGCGAGTGCTGCATTTTC AGG Intergenic
No off target data available for this crispr